Supergirl and the Last Human

Have stories to share? Post them here! All writers welcome.
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Supergirl and the Last Human

Hi all, thanks for checking this out. I hadn't planned to write for a few months, but I was so pleased with the reaction to my last story that I kinda got the urge again. The updates on this one will be a lot less frequent than usual though.
Content wise this will be the same as my previous SG stories, Curse of Merlin and Mayan Prophecy (peril only) and I suppose loosely it forms a kind of trilogy where SG has faced foes from the past, present and now ...well take a guess! ;) , though I didn't really intend things that way its just how its worked out. To new readers, you don't need to have read my other two stories first to follow this one, they are independent of each other


As a thank you to all who took time out to post against those stories, as a bit of fun and a challenge to myself I decided to give every one who has posted a comment against either of the previous two stories a mention in this one.

Some are more frequent than others, some are minor characters, some are other things and some didn't give me a lot to work with in the first place (YES YOU, SGZ6! :wacko:Lol ) but as I say its just a light hearted token of thanks. The prominence or otherwise of your user names in the story bares no reflection on anything else other than the ease or awkwardness that I could fit you in. Like I say just thought it would be a bit of fun for you guys to try and spot each other. Some are obvious, some are phonetic, and some have bigger roles to play than others, but I hope you all are not disappointed by whatever role (or mention) I have given you.(apart from SGZ6 but hey, sorry man) I mean no offence to anyone, so if you are upset or dislike me using your usernames in this way, please pm me and I will remove them. Its not my intention to upset or anger anybody. (but given the title and our story starts with the annihilation of humanity, its probably fairly obvious most of you will meet a sticky end!). Any attributes I ascribe are to the characters in the story and bare no relation to the users even though they may be named after them, as I have never met any of you. So some may be female and the user is a man etc I have no way of telling, by and large. Some are bigger challenges than others (Literary Gary?!!!!) AND jsut when I thought I had them all pegged, 'SamtheWise2' goes and adds a comment :) . Oh well, I wanted a challenge, and now I have one!

After I have finished the story I will edit the posts and put the names in BOLD or colour so they stand out. Like I say anyone who wants to opt out, let me know .


For the opening, if you envisage a cross between the start of Battlestar Galactica and Starship Troopers it may help! :yes:

And if anyone thinks the concept is too ridiculous look up the 'tardigrade' - you can boil it , you can freeze it and its even survived outside the International Space Station.

Anyway, I hope you all enjoy it, please feel free to post any comments good or bad

Supergirl-Helen-Slater-33.jpg
Supergirl-Helen-Slater-33.jpg (92 KiB) Viewed 20930 times
Last edited by tallyho 10 years ago, edited 5 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

PART 1

A blinding white flash filled the view screen as Copenhagen exploded.

“What was that?!!!” demanded the All-Father.

“The Copenhagen, sir! Warhorse class…she was on the far right of the fleet…”

“How many Deracon vessels?... How MANY!!!!!?” the All-Father screamed impatiently at the Tactical operator.

“W-We don’t know, All-Father…the targeting computers whited-out there were so many…they are without number…” And that was the problem. The weapons, each thought-linked to an operator, needed to focus on a single targeted point, but were failing to lock on at long range. And when the alien creatures had closed to visual range for the scanner cannons, it was too late to stop the huge numbers. This was the 18th such wave they had encountered in less than half a solar hour.

As the blast from the destroyed warship dissipated, a new wave of enemy vessels appeared on the 3-d screens, swooping in on that sector of space like ravenous vermin as they swarmed passed the wreckage. Thousands of their own had been destroyed in the blast. But they did not matter.

“New wave sighted …ten…over twelve thousand…” the Tac Op stated clinically. The insectoid races that made up the Deracon were vast in number. Their ships were small organic vessels using bio-technology and electro kinetic impulses. They were as insect-like as the alien creatures they carried. But these were not the minute insects of Earth. They were large creatures of different insect species ranging from some the size of dogs, to others the size of horses, to these living creature-ships, roughly the size of a small house, each carrying five or more of the smaller insects inside it. Their weapons were mostly short range formic-acid based mines and streams. The Earth Empire vessels were huge, many over a mile long, housing tens of thousands of the Terran Order. One Terran ship was worth a thousand, maybe even ten thousand of the alien craft. But they thought nothing of mass sacrifice for the good of the Hive Mind.

The tiny ships swarmed in close around the next Earth vessel of the Terran Order, the Rhadmanthus. She was pounding away with all her cannon, taking out hundreds of vessels with each desperate salvo. Even the destroyed alien ships exploded in a spray of acid that ate through the hulls of the Earth fleet, the droplets floating in space, almost invisible until the ships flew into it unwittingly. As the living ships swarmed around Rhadmanthus’ hull, it became obvious she would soon share the fate of Copenhagen. Bellerophon moved in closer to try and aid her, but when Rhadmanthus detonated, she too went with it. Thousands of the Deracon were also destroyed in the dual blast but the tide was unstoppable.

This was the largest single fleet the Terran Order had ever assembled, all ten sector fleets massed for the first time, over a thousand ships; yet it was not enough against a foe in tens of millions. They had engaged with over 400,000 fighter drones of their own and comfortably had the upper hand for the first twenty Sol minutes or so, but now, with more enemy emerging constantly, the situation was grave for the human forces.

From the command deck of the Warspite, even now, with the engagement just 40 Sol minutes old, it was obvious this day was against them.Warspite was the largest Terran ship ever built, over a mile and a half long and a home to 42,000 crew, mostly Thought-Gunners. Her decks were crammed with research stations, armouries and weapons development facilities, everything needed for a distant military campaign across the vast reaches of space. Most other ships were barely half a mile, with crews half her number. Yet today they were proving little more than large coffins. Over three hundred ships had been overwhelmed, with new victims every moment as the alien fleets kept appearing from Null Space on every quarter, massed waves that overwhelmed ships at the fringes and opened up gaps in the battery fire defence for the next wave to pour through.

The All-Father gripped the bracing rail until his knuckles were white. This was the end. For six centuries since the Eugenic Wars, the Terran Order had known only victory as it had expanded across the galaxy, bringing peace and order as chaotic worlds were absorbed into the fold, cleansed if needed and then colonised. Thirty eight of them. When Earth had expanded, her sons had sought out the nearest star system, Proxima Centauri, established an outpost on a rugged little planet, Talomere, then later a mining colony and then moved on. Slowly at first, but then with faster drive engines came faster colonisation. From nearest star to nearest star, if no suitable planet was present then on to the next nearest star system. Thus, the Earth Empire had a linear shape, a strange, sinewy ribbon, with the home planet two thirds along its length rather than at its centre. There had been some lateral expansion but those colonies had not done well, hindering their use as jump off points. There were always vast profits with new world outposts and so the juggernaut of colonisation rolled ever onward, never waiting for the total occupation of a world before moving on to the next. In pure, established planetary terms there were only nine fully functioning worlds comparable with Earth, and only three of them had been fully explored and occupied. The rest were small colonies in their infancy. Then the fateful day had come when they had crossed paths with these nightmare creatures, the Deracon. There had been hardly any change at first as the Order had proceeded as normal to occupy the outlying worlds of the Hive Mind. For several decades little had altered in fact. As an enemy, they had been dismissed as naturally inferior. Mere insects, they had posed little problem other than their numbers infesting the prospective colony world. Telepaths who scanned the creatures confirmed the presence of a central commanding force, dubbed the Hive Mind, but all who had mind-bonded with the aliens had been driven mad. As a prospective threat to the technically superior Terran forces, they had been dismissed. They had been successfully exterminated from the planet Mieros, leaving it open to colonisation.

But then they had come back, in their tens of thousands, ultimately millions, retaking Meiros, then world after world and eradicating all outposts of the Order.

The fact that they, simple insects, could travel through space had been an unpleasant shock. The first of many surprises, as some 14 colonies had been successively overrun during the next decade. Now they were within striking distance of the first planet wide colony, Adira. The decision had been made to bypass the leading insect forces and go straight for their home world, where ever that might be, as that way they would cut off the resupply of fresh creatures whilst the smaller defence ships, massed gun platforms and weapons satellites would be able to keep them at bay. The creatures advance force would effectively wither on the vine. But it had taken four years just to assemble the fleet in one place as the ten fleets were recalled from all parts of the Empire, before they could carry all before it as one massive, unstoppable force. That was the plan. Now it had led to this ominous day, perhaps the last day the Order would ever see. And once this fleet were destroyed, nothing seriously stood between the Deracon and Earth.

For if they could destroy every large fighting ship the Order could muster, then the local defences would be as nothing at Adira, Addison Haven, New Cambria and the rest of the nine planets. The All-Father was gripped by a terrible despair. With disbelieving eyes he watched the end of all he knew.

In the van, ‘Lionheart’ was blazing away with all her batteries when she suddenly split from stem to stern, rippling with small explosions all along her hull as she inadvertently sailed through an acid stream. She didn’t blow up, but just cracked open, like an egg, vast expulsions of oxygen and debris billowing from her. A handful of escape pods launched before they too hit the invisible acid stream that first peeled back the layers of their fragile hulls and then caused them to implode, the outer skins denting and buckling in as the occupants were crushed by the pressures of space. Her forward batteries were still firing as she lived up to her name, but finally they too imploded.

“TAKE US IN CLOSER!” The All-Father commanded. Lionheart was a talisman for the fleet, having endured four previous encounters with smaller Deracon forces.

“It’s too late, sir! Those images are already 10 seconds old!” his Navigation Operator told him. Lionheart’s sistership, Salahaddin swung into view, veering across their path as she desperately tried to avoid the same acid stream that had claimed her sibling vessel.

“EVASIVE ACTION!” the command was needless as the ships thought-linked computers were already responding to the Helmsman’s own reactions. Warspite avoided the danger but it was not the same story for the Bertrand de Guesclin, as the Knight class vessel ploughed into the unseen threat in spectacular fashion as her bridge absorbed the full impact of the deadly acid. A vivid flash erupted from the ship and her command crew were killed as the vacuum claimed them. The auxiliary bridge crew took over from their stations in the bowels of the ship almost instantly, but as more of the alien acid stream struck her, the end could not be far away as her hull was breached, venting oxygen.

It was too late for all of them. Spirit Caste members were praying to the First Father quietly, as the Warrior Caste launched in the last of the fighters. The drone fighters had made little impact on the vast alien fleet before they had been overwhelmed and now the last of the manned fighters were being used. They would fare little better than the drone ships. The representatives of the Political, Science and Technical Castes were staring silently at him. As the All-Father, it was his position to guide them, to steer them to the divine victories they had enjoyed under previous All-Fathers. That would not be happening today.

Suddenly the doors opened and the chief of the Science Guild, Timon, rushed in excitedly. He made the sweeping sword-slash greeting in salute, fist passed from left shoulder to right thigh, and began with the ritual address.

“May your sword stay sharp and true. My Foe is Strong…”

“But I am Stronger” the All-Father answered with the formal acknowledgement. Those words rang hollow today.

“SIRE! The Chronos Drive, sire! It works! We have already sent through the time probes. And we have an answer!” Doctor Timon cried, euphoric.

A series of bright flashes and explosions washed over the large viewer, causing him to look up for the first time and take in the scene as some nine ships lay visible in flames. Shocked, the Doctor looked back at the head of the Terran Order in horror, then around at the other screens, all showing fleet members in different stages of destruction, in holographic 3-D.

“Sire, this day may have gone against us…but we can now change ALL OUR DAYS! This battle can be avoided! We have the team ready. The drive is only a prototype, we can only send a small group back, with representatives of each needed caste, but you can guide them Father!”

The All-Father snorted. “Huh. Guide them? Guide them to what, oblivion, as I have this fleet? You are wrong, Doctor Timon. This is not a battle. This is a disaster.”

“Sire, we can find The Angel. We can gain her help! She can aid us in our time of need! It is said she will save us, as she did the First Father all those centuries ago, before The Falling of the West!”

“ ’The Angel of the Elements, who could control fire with her gaze and freeze water with her breath, who defied the winds of the air and had the power of the sun at her command’” He quoted the Holy Journal word for word. ”’One who would save all mankind,’” he snorted in derision. “A fairy story, a story for children!” He said dismissively.

“No, sire! The probes have confirmed it! They scanned the ancient databases for news of her, and they found it! Look!” the Science Guild member held up a data orb that started to replay its holographic message. As three more ships of the Order erupted in blue and red explosions, somewhat ominously The Empire of God amongst them, the All- Father viewed the image, thought-absorbing the content directly to his mind. And for the first time that day, he smiled.

“She IS real! There really was an Angel…and she can save us all!” Timon mirrored his leader’s smile.





“Hey, Louie!” she called, but the old janitor couldn’t hear her over the sound of his vacuum. The headphones that were playing Queensryche’s ‘Operation Mindcrime’ weren’t helping either. And neither was the fact that he was inside the glass walled gift shop at the top of the 80-storey high Metro Tower, whilst she was hovering 15 feet away outside it, beyond the balcony. She waved but the elderly black cleaner couldn’t see her. Finally she emitted an ultrasound note that made the windows gently rattle, causing him to look up. It was her form of a polite knock, rather than raising her voice which might have shattered the glass and given him a heart attack. He stopped, pulled off the headphones and killed the music, offering a casual wave as he saw her and smiled. The golden hair, rich blue top, red skirt and cape meant it could only be Supergirl. And of course the fact that she was hovering 80 floors up. She returned his infectious grin as she waited for him to slowly trundle over to the door and open it.

“Well hullo, SG! I heard the windows go an’ I says ‘Louie, you gots a visitor’. ‘Visitor?’ I says to mysel’, ‘can’t be no visitor, no one comes to see ol’ Lou’ and then I looks up an’ it’s you! Now don’ that beat all? Been a while! C’mon in, I’ll put the coffee on” he said with his strong southern drawl.

“Oh I can’t stop tonight, Lou, I’m out an’ about. Something’s up. Can feel it in my bones. Just stopped by to say ‘Hi’” she smiled apologetically.

“Wish you’d come in S g. Gives me the hee-bee-geebies just seein’ ya’ll hanging there, like that, with nothin’ under you…ain’t right!” the elderly coloured janitor shook his grey haired head. “No, sir. Ain’t right at all.”

“Another time. I’ve missed our little chats.” She said and meant it. She would often swing by and spend a half hour when the cleaner was on his break. It was 2 in the morning and far below them the city was asleep. His seemed a very lonely job, stuck high up in the sky with the world beneath him but with no one to talk to. She had flown by one night and he had waved, then invited her in for a coffee and their unusual friendship had grown from there. A part of her realised that she was drawn to him because she shared his loneliness at times, but here, high above the city, when the crowds had gone home, they could be lonely together. She loved the timbre of his voice – he had a throaty resonance that reminded her of Scatman Crothers. Whenever she talked to Louie, she had a vision of herself talking to Hong Kong Phooey.

“You still listening to that heavy metal? You’ll ruin your ears, Louie.” She said with a mock frown and a shake of the head. “Shouldn’t it be Motown, a guy of your age?”

“Been doin it for 30 years, too late to stop now.” He smiled, his white teeth gleaming. “Motown? You stereotypin’ me girl? Be N’Orleans blues if it was anything else, but I likes my metal!” Then his smile faded as he saw her frown for real as she squinted and scanned the lights of the city below them.

“What’s up then SG? Your Spidey-sense tingling?”

“Er… no Lou, that’s a guy thing.” ‘And might well be a euphemism for getting an erection’ she thought to herself and smiled secretly. “I dunno …just…I can feel an energy vibration, a charge in the air like …like there’s a storm coming or something’s out of whack….or something bad is gonna happen…” she frowned. Maybe that was her ‘Spidey-sense’ afterall.

“Well, there’s a storm o’er there…a-ways out to sea…” he pointed behind her as there was a flash of light. “Guess the lightning was too distant for the soun’ o’ the thun’er to carry.” He went on, but Supergirl wasn’t listening. She was frowning at the distant speck on the ocean, shooting up only 5 or 6 millimetres above the horizon it was so far away. It was too quick and too distant for human eyes to pick up on the subtle nuances, but there were several things wrong with it right from the off.

For one thing, it was dead straight, a bright white beam rather than the crazed blue tinged fork of a lightning strike - it seemed to just travel up so far and then simply disappear. For another it was coherent light, travelling in pulses which contained light encoded information. With her Kryptonian vision she could see even at this distance the data parcels travelling along its length, represented as slight fluctuations in the light intensity. No human eye could have spotted it. Once she got nearer she may be able to work out what was being transmitted. But the biggest giveaway that it wasn't a conventional storm, was the fact that it was traveling UP from the ocean into the sky.

“Lou…I gotta go” she said as she instantly sped off towards the light source.

“Be careful, SG! “He called after her before mumbling to himself as she had already gone “She ain’t a-listening, she ain’t gonna be a-careful…” shaking his head scornfully.
Last edited by tallyho 7 years ago, edited 3 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
imyoursub
Neophyte Lvl 2
Neophyte Lvl 2
Posts: 11
Joined: 15 years ago

Re: Supergirl and the Last Human

Just wondering, but wouldn't formic acid, no matter what pH it has (though a pH low enough to melt through metal, especially that quickly, would cause serious problems for the animal that contains it), freeze upon contact with the nearly absolute zero temperatures of space?
Beyond that, very nice beginning, can't wait to see the rest!
Of course I'll give you the traditional last wish Virago! After all, what could be the harm in looking into your... eyes...
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Hey, they are aliens they can handle it! But in my defence I didnt say it was formic acid, I said ' formic acid based' :D I just picked an acid that insects produce and use and souped it up.
Don't think I said the ships hulls were.metal either... :D
(To be honest a much bigger hole is how they could propel themselves through space! :D
But I managed to dodge that one!)

Thanks for the comment, hope you enjoy the rest.
T.
Last edited by tallyho 13 years ago, edited 2 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

the story is developing well, eager to read more
User avatar
Caniac89
Sargeant
Sargeant
Posts: 123
Joined: 18 years ago
Location: North Carolina

Re: Supergirl and the Last Human

If we're gonna question the properties of acid in space, then how about we focus on the much larger detail that defies physics, a flying blonde girl! LOL I'm just kidding, a fine start Tallyho.
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Caniac89 wrote:If we're gonna question the properties of acid in space, then how about we focus on the much larger detail that defies physics, a flying blonde girl! LOL I'm just kidding, a fine start Tallyho.
Thanks! But just a query, is the issue that she can fly or that she is a blonde who can fly?LOL! Would a flying brunette be more plausible? :D

Incidentally fitting your user name in took a lot of creativity, I hope you spot it when it appears!

Thanks to all so far who have dipped in to it, all comments welcome. Hope you enjoy and if nothing else its educational! :D
T.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
989inaga
Neophyte Lvl 2
Neophyte Lvl 2
Posts: 11
Joined: 21 years ago

Re: Supergirl and the Last Human

Hi, Love your stories, but you must write another Grace Sisters tale. They can't be through with Wonder Woman yet.
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

T, finally got a chance to read this. Interesting start for sure! The bit with SG being friendly to the Janitor was nice. Looking forward to more.
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
DrDominator9
Emissary
Emissary
Posts: 2486
Joined: 15 years ago
Location: On the Border of the Neutral Zone

Re: Supergirl and the Last Human

Nice beginning, T. Reminds me a bit of the classic story "Ender's Game" by Orson Scott Card. Except he didn't have a flying blonde, brunette or redhead. Looking forward to more of this.
Follow this link to descriptions of my stories and easy links to them:

viewtopic.php?f=70&t=32025
lilily
Neophyte Lvl 2
Neophyte Lvl 2
Posts: 16
Joined: 13 years ago
Contact:

Re: Supergirl and the Last Human

interesting story...
enjoy zentai, enjoy life!
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Thanks all for the comments. Two of you were mentioned in the first part, a few more appear now :D

PART 2

As Kara neared the intermittent beam it became too bright for even her to look at, so she switched her Kryptonian sight to a different part of the spectrum. Sure enough, she could see the micro pulses of a data stream embedded in the light beam, a fraction of a microsecond apart. To any human person it looked like a constant stream of light, but to a Kryptonian, it was clearly a message in the light particles. There was something else though – it seemed to have an energy field around it, that developed and got stronger as the pulses neared the top of the beam, where it appeared to just end abruptly. Whatever it was, it certainly wasn’t lightning.

As she studied it with genuine interest, she tracked the beam back down, below the level of the slightly choppy waves, looking for its source. Intensifying her gaze she could see it disappearing down into the depths. Nothing for it. She took a deep breath and plunged as quickly as the pressures would allow down to the source, some two miles distant, at the bottom of an Ocean trench with the uninviting name of The Widow’s Valley. There she found a small flat circular device, a metre across, like an enlarged frisbee. It was quite thick, metallic and emitted the light pulse from a circular hole at its centre. There was a second ring around the hole that emitted the curious energy field that got stronger as it travelled higher up around the beam. She x-rayed the device and confirmed her suspicions- it was not of conventional manufacture, but extra terrestrial. Yet the technology looked remarkably human. She could see too, that the energy field that surrounded and grew around the pulse was also remarkable. As far as she could tell, it was temporal in nature. She could see bizarre distortions at its fringes, like a film speeded up as successions of waves, fins of whales, fish, a part of a boat and even a piece of the dark hull of submarine flashed into existence before her eyes, almost instantaneously. All, she realised, must have passed that point at some time, and the energy field acted like a window on that brief instant. A temporal energy field explained a lot. That was why the light pulse seemed to disappear as the energy field grew stronger and fully formed around it. It created a time distortion. So the question was not where the message was being sent, why, by and to whom, but also to when?

She examined it for a further ten minutes before the pressure on her lungs made even her return to the surface, but first she retrieved a small stone from the ocean floor. At the surface she spun around rapidly in mid-air for a few seconds to dry herself off, then moved up to the top of the beam, just where it disappeared. She flew up and over where it should have continued, approximately ten feet above the point where it ended. When she looked down directly at the beam path it was invisible – she simply gazed down at slightly distorted rough ocean waves. She relocated to just above the wave crests and placed her head as close to the beam as she dared. She looked down and at the point where it broke through the waves she focussed her attention. She was instantly able to see that it was the same nine or ten data packets on a repeating transmission. An SOS? Possibly, but unlikely given the source was just a transmitter rather than a spaceship. The beam itself was approximately a foot across. She hefted the stone in her hand, paused a moment in thought, decided to bite the bullet and then tossed it into the beam path.

There was a blinding flash that engulfed her in a ball of light for an instant, before it and the beam disappeared with a soft ‘krummmp’ noise. She had reacted instantly, instinctively covering her head and face with her arms and curling into a foetal position in mid-air in the nanosecond before the light engulfed her. The same innate Kryptonian powers that protected her from the harshness of space protected her now. A rumbling explosion and bubbles speeding to the surface indicated that the transmitter had done a ‘Mission Impossible’ audition and self-destructed.

“Gee, that went well…” she said drily to herself. She quickly flashed a glance upwards, checking the positions of the stars and found to her relief that only an instant had passed and she was still in the present day. She let out a long slow breath as she pondered the meaning of the brief glimpse of the data stream she had seen as the light enveloped her. But the transmission was not simply English, but a strange mix of tongues; part Chinese, part Hindu, part English. As best she could figure it, part of the message seemed to be ‘Media scans completed. She is of this time.’

That at least answered one question, in part, she thought. The object had been sent to find someone. But who and why was still anybody’s guess, and so was whatever the remainder of the message had been. Were they looking for her? Possibly. And of course, the question posed by the temporal field still remained – when were they looking for whomever it was?

The answer to that last question lay in days yet to come, some seven hundred and forty eight years in the future.


The All-Father gazed at the replayed transmission in the data orb. “Pan back, times 30 reduction.” The Science Guild technician, Doctor Timon, commanded. The data information shrank from the readable message to a point of light. “Watch closely,” he commanded his superior.” Wait….THERE!” He cried excitedly as the small point of light flared into a white flash. “Stop!” He commanded the orb player, and the holographic vision was frozen. There , frozen in the flash was the tiny dark silhouette of a figure. “Enlarge.” He beamed at the All-Father as a nearby ship disintegrated, the ‘Midway’, the blast wave from her engines going up rocking the ‘Warspite’.

“Sire! Gravity mines deployed! We have a screen on two sides! This is our chance to withdraw!” Fleet Admiral Manx cried desperately, but the All-Father wasn’t listening. He was looking at the shape of a humanoid figure caught in the burst of light. It was the figure of a woman.

“Could it really be her?” The All-Father whispered to himself, in reverential tones.

“Could it be anyone BUT HER?” Timon of the Science Guild countered. “Who else but The Angel could defy a temporal explosion?”

“You are sure she was not harmed?” the leader asked the Science guild chief.

“I…I think so…” the Doctor said falteringly.

“She may have been dis-entimed by the blast. Have you not run the Elemental trace for her chronology? To see if she has been cast adrift through the ages? Pray to the First Father that she has not for your own sake.”

“Sire, the probe was destroyed by the feedback loop when the beam was broken, we could not run the Elem trace “C” protocols. But she is alive, I would stake my life upon it, sire!”

“You already have.”

The Chi-Bi erupted in a fabulous green explosion that had an almost mesmerising beauty to it, but when it cleared after a few seconds there was nothing left of the Battlefield class warship. She had been one of the ships carrying the chemical purge weapons for when they reached the Deracon home planets. But, unbeknown to the Order, there were no home planets of the insect race. They were all parts of one massive interactive colony. Of over a thousand worlds. To the Deracon, there was no such thing as an uninhabitable planet. It was just a question of evolving the necessary creature to live upon it. Manx watched the explosion with dismay.

“ALL-FATHER! WE MUST WITHDRAW!” Admiral Manx tried again in desperation. “We still have to wait for most vessels jump engines to get back on line…we must buy time by retreating. I propose a fighting retreat, giving time for the engines to charge.”

“Yes, yes. Do it. We will fight them another time…” the All-Father said absently, still staring at the tiny dark silhouette in the orb. And he meant it literally. “Withdrawal pattern ‘K’, 99 Sol second intervals between waves of escaping vessels.”

“As you will it, withdrawal pattern ‘K’, sire, 99 solsec intervals. Those ships who are able to jump, to retire to Acheron outstation as and when able. ” Manx gave the order with obvious relief. It was short lived.

“BY THE FIRST FATHER!!! ITS TOO LATE! LOOK!” All on the bridge turned to the array of 3D view screens that gave a 360 degree view in all directions around the ship. What was left of the fleet was arrayed predominantly to the rear, above and left side of the Warspite. The right flank had been hardest hit. On all screens vast rips in Null Space were forming around the fleet and millions of the enemy ships were jumping into normal space. The gravity mine screen destroyed hundreds of thousands almost instantly as they appeared, but once detonated there was nothing to stop the remaining millions of live ships that popped into existence all around the fringes of the fleet.

“We are betrayed!” Surabati, the Political Caste bridge member cried. They saw conspiracy theories everywhere. The All-Father sighed.

“No, no we are not” he said wearily. Null Space allowed jumps from system to system over a set range of distances. He realised now, that the Hive Mind had stationed fleets at ALL the Null Space entry points to their territory. The first few hundred thousand Deracon ships that had met them here were just a sentry fleet, one of many. They must have signalled the other fleets, hence the endless streams of vessels continually emerging through the Null space rifts. Only now did he really appreciate the scale of their enemy. The Terran Order forces had already destroyed tens of millions of the creatures in this battle alone, yet their forces were in billions, he now realised. All kinds of abnormalities manifested in each batch of millions of creatures, and billions upon billions of batches born each day, on each of their occupied planets, just like insects back on Earth. Perhaps a hundred generations in each twenty year human one, perhaps a thousand. Constantly evolving and adapting. Creatures that created the acid; that could become the living ships that could breathe all kinds of atmospheres; that could colonise, resistant to all kinds of pressures. These differences preserved; each oddity in each generation then bred specifically for that feature, that supposed deformity, until you had millions of each or more. It was simple really. As the order had striven for genetic purity, so too, the Deracon had striven for mass diversity, the better to survive. It would seem their way would win, at least today.

But maybe not, if they fought the battle yesterday, or rather in the past. He weighed the ever decreasing options in his mind, before Timon addressed him.

“All-Father –you must use the time drive! You must flee! You alone can contact The Angel! The team are ready. Take them back to her time! Find the Angel! With her aid we can achieve our purity of being centuries ahead of this time! We can be ready for when we meet these…these vermin. You can still lead us to victory, All-Father! With her help. And you must!” Timon finished triumphantly as the Kennedy detonated silently in front of them on the screen.

“Enemy forces are in 58 distinct groups…more are appearing all the time…” the long range Scanner Operator said. “Upto 65 now….” Their numbers were so massive now that huge tracts of space appeared as a dark mass as the creature –ships blotted out the background stars.

Timon surveyed the screens desperately. He was not of the Warrior Caste, but you didn’t need to be to know this venture was doomed. Time was running out. But he needed special permission from the All-Father to access certain records – the knowledge of the previous All –Fathers- that the time group would need to take with them if they were truly to change this terrible day and avoid the disaster currently engulfing humanity all around them.

Reluctantly, he broached the subject. The All-Father was notorious for his rages.
Hesitantly, he approached the supreme ruler “All – Father, can I ac-“

89 waves and still more appearing!!!” the Scanner Operator interrupted him. His voice was panicked.

Timon tried again. “All-Father, I need to access the Knowledge of the Fore Fathers. Do I have your permission? You will need to take copies of their wisdom with you.”

The All-Father gazed up at the screens, all showing a terrible end to the once invincible Black Fleet.

“Look, Doctor. Dominator, 9th Fleet flagship meets its end…” he indicated the colonial City-ship with a sweep of his hand, carrying over 100,000 of the Warrior Caste, the Stellar Knights. One of ten Fleet Transport Assault craft, she was by far the biggest. They were in case any ground assault of the insect home world were necessary. The Knights were the core of the Armies of Oblivion that had suppressed the Taxation Revolts on four of the older colonies. Dominator had been unstoppable, delivering her human cargo into the heart of the rebellions’ outposts, fighting off scores of defected ships. But now she was ablaze with a savage intensity from nose to engines. “Could she truly save us, Doctor? Could she change this day, avert my end? Or yours, Doctor, or save the 9 colonial worlds and Earth itself in the months and years to come? Could she really change all that we have lost this day?”

The Doctor looked aghast at the terrible tragedy played out before him, as the All-Father continued.

“And there, Doctor. Avatar…” He gestured to the scene on the main viewer, where Avatar, still firing, was engulfed by the alien horde. Her hull was completely covered in the enemy multitude, making her a teeming mass of insects. Her guns fell silent, probably because her thought-gunners could no longer see the targeting screens as the viewers were covered and did not wish to hit a Terran vessel. The creatures jaws were biting into the advanced regenerative polymer plates of the hull, peeling it back and firing their concentrated acid into the exposed interiors. For the living ships were insects themselves. Avatar fell out of fleet position and broke away, heading towards the onrushing waves of the enemy vessels, determined to sell herself dearly and take as many of the horde with her as she could. Her silent detonation on the view screens was strangely poetic. A long, sad, silent requiem for a lost cause as the explosions slowly escalated in ferocity through her shattered decks.

The All-Father turned back to face Timon, clearly wracked with doubt “You really think this day can be avoided, averted, a changed history created where we triumph?”

The Doctor nodded. Then he turned to face the terrible destruction on the view screens. “What do we have to lose by trying?” he said reasonably.

In the centre of the command bridge a tiny holographic 3D map of the fleet arrayed all 1,132 vessels. Or used to. Now it showed around half that number. It was struggling to cope with representing the millions of enemy overwhelming them. Huge swathes of vessels had been destroyed. Only the rear left lower flank of the fleet had sustained little damage. Largely due to the presence of one vessel, the Mother of Voices. She was a prototype vessel, one of only two, and was little more than an engine lashed to a giant sonic cannon. Her sound pulses had proved extremely effective but they were slow to generate and tended to disrupt the Deracon initially, rather than destroy them. Only multiple blasts caused the silica-based lifeforms to disintegrate, but her sonic waves covered a vast arc of space. The ships around her were buying time for her to recharge between pulses, before she returned the favour by scouring the insects from the immediate vicinity with her sound waves. Her sistership, Siren Song, had generated different frequency pulses, which had proved less effective, but she had been overwhelmed when she had rashly moved to the fringes of the fleet. Mother of Voices would not make the same mistake. If they had had a few more such vessels the day would have been very different.

The All-Father followed his gaze to the 3D fleet display. Every few seconds saw more blue vessels in the fleet vanish or turn black as they were destroyed by the acid or disappear beneath the red mass that denoted the Deracon vessels. He nodded, reluctantly to himself.

“Which probe found her?” the All-Father asked the Doctor.

“It was searching time-sector Sierra Gamma, zone 6, early 21st Century. Eastern sea of the Island of the Americas. Sire, the records…?”

The All Father nodded. “Very well. You may access the Fore Fathers wisdom. We go to SGz6. Lead the way.” He turned to face the crew on the war deck bridge. “I assume we cannot jump whilst travelling through the time portal?” The Doctor nodded. “Manx, hold as long as you can.” He turned to Timon. “How long will we need?”

“One Sol hour…” Timon looked up at the shattered hull of the Witch Head, a Nebulae class destroyer. It was in two large pieces with its oxygen burning up from the split. “Twenty Sol minutes” he revised his estimate downward.

“You will have it.” Manx assured them. “Our Null Space engines will not be charged before then. Warspite to all vessels. Close up. Protect the All-Father”. He turned to his leader. “We will unleash the rad devices”. He gave the order to use the last resort weapons. “Signal the Terminal ships.” He issued the order and the traditional three word order signal was transmitted -The Empire Calls.. The Terminal Ships' Captains knew what it signified.

There were four Terminal ships in the fleet but Warlord was already destroyed, whilst Chieftain and Overlord were severely damaged.

Only one remained operational, and she answered the call now. She was the Centurion.
Last edited by tallyho 12 years ago, edited 4 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Nice work T!

For some reason I can't place I had the funny feeling I saw some of that before.... :smart:

More on topic, actually enjoyed all the little Easter Eggs there. It was fun seeing how many I could spot. Also quite happy with that last one there :D

Keep it up
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

Apart from this interesting story, sometimes I wonder if he had appeared, congratulations for the great Chapter
User avatar
Centurion
Staff Sargeant
Staff Sargeant
Posts: 174
Joined: 16 years ago

Re: Supergirl and the Last Human

Are my ears burning? :)
User avatar
DrDominator9
Emissary
Emissary
Posts: 2486
Joined: 15 years ago
Location: On the Border of the Neutral Zone

Re: Supergirl and the Last Human

Excellent set up of the possible annihilation of the human race. Can our girl save us all and live to tell the tale against millions of insects. Gives me the creepy crawlies to think of it! Think she'll be able to rack up a good tally, ho?

Cute use of buried treasures to keep the reader's eyes peeled.
Follow this link to descriptions of my stories and easy links to them:

viewtopic.php?f=70&t=32025
User avatar
ksire_99
Elder Member
Elder Member
Posts: 443
Joined: 17 years ago

Re: Supergirl and the Last Human

very cool setup.

One minor complaint though...I don't retreat, more likely to double down on my mistakes :laugh:
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

sgz6 wrote:It was fun seeing how many I could spot. Also quite happy with that last one there :D

Keep it up
Hmmn....thanks but I'm not sure why you were so pleased to see 'Centurion' there? :D
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Centurion wrote:Are my ears burning? :)
I dunno...were you doing the ironing when the land line rang? :D
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

ksire_99 wrote:very cool setup.

One minor complaint though...I don't retreat, more likely to double down on my mistakes :laugh:
You didn't retreat, it was a withdrawal! :D

I hope you appreciate I only had them address the leader as 'Sire' to make it easier to fit your name in! LOL!

It's been really weird writing this in that sense as many aspects of the plot have only come about because I had to think of ways of fitting in the usernames

My apologies to dravatar - I think of you as Doctor - avatar rather than drav-atar so if you are the latter, sorry 'doctor' as in the abbreviation 'dr' -avatar was the only way I could fit you in

Thanks a lot guys , glad you are getting a kick out of it.
Next part will be up next weekend.
Cheers
T.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

With apologies to Mr Kipling's ghost.

Part 3

The Centurion came hammering through the ranks of the fleet, her engines flat out and all her guns firing at maximum pulse. She was loaded with atomics, and like the fire ships of old, she was destined for a one way trip to the heart of the enemy waves and thence oblivion. She had a skeleton crew of volunteers, mostly gunners and the bridge crew, plus the thought repairer teams who would endeavour to keep her going as long as possible. Her Captain, Valeri Ugisako, appeared before the All-Father now, as a hologram. Like two thirds of all the Empire population he was of Asian – European descent, but unlike the majority he was of Japanese rather than the usual Chino extraction, his genetics specially engineered to preserve beneficial elements of both strains of humanity. A decorated hero of the Suppression Wars, where the rebellious colonies had sought independence, he was known throughout the fleet and was considered something of a lucky charm.

Largely because he had fought 4 losing battles against the Deracon in a Terminal ship and not been required to destruct.

“It is an honour for us to serve the Order in this way, All-Father. We will salute the fallen as we join them.”

“We will honour your sacrifice” Manx said stiffly.

Valeri Ugisako smiled. He seemed to be genuinely enjoying his moment. “With the power of our convictions, there is no sacrifice to be made. Admiral.” He bowed and his tall, lean image disappeared.

Manx swallowed hard. He had always liked Ugisako and it pained him to lose him in this way. It wasn’t even a do or die attempt to gain victory, the original purpose of the atomic fire ships. Drone craft had been used in the past, but there were difficulties with enemy ships jamming the electronic detonation signals. He doubted whether the Deracon where capable of such acts but now it did not matter. They had manned Terminal ships for a reason and the reason was they were better suited than android crew or drones. Human Captains knew the optimum time. It wasn’t anything that could be programmed or taught. It was instinctive among the Order warriors. There was a time to live, and a time to die. Now was Ugisako’s time. Manx suspected they would all be joining him soon enough. He thought bitterly of how they had catastrophically underestimated the insect numbers. The initial patrol group that had encountered them for the first time, when the Deracon reclaimed the Meiros colony, had only been 6 ships. They had been overwhelmed without getting off a single transmission. In the subsequent skirmishes the numbers of ships committed had escalated. First 10 – lost with all hands. Then 18 ships committed, 4 survivors. Finally a fleet of 38 which would reclaim Meiros for the Empire, for once and for all. 9 survivors and Meiros lost. Then a string of small engagements, some won, many more lost, but never against more than several hundred thousand of the creature–ships. The analysts estimated a total insect force of between 10 and 25 million, but spread out, expanding on all fronts and slow moving compared with the Earth vessels. A massive, concentrated strike would be decisive. So they had assembled the fleet. With any transmissions between Earth taking 18 sol months, it had taken years, but they had done it. 1,132 vessels. A single, decisive strike into the heart of the enemy. A deathblow, a day of decision. And here they were. This day would prove decisive, but it would surely go against them. Manx felt sick to the pit of his stomach. How could they have been so stupid?

A fraction of a light second above the Warspite , some 38 conventional miles distant, at the top of the fleet, Ironchild suffered a catastrophic acid hit that sliced through her like a knife blade. The ripple of explosions, all along the cut, angled the aft wreckage downward, as the engines, still powered but now devoid of control, sent two thirds of the ship spiralling down through the body of the fleet, slicing through The Siege of Nidum Vale, named for the last battle of the Suppression Wars, before ricocheting into the Admiral Marabas and the Cheng Du. All four ships caused havoc at the core of the fleet, as ships tried to get out of each others’ way. That was the problem the Terran vessels had – too close and they had little steerage room, too dispersed and they were easier to overwhelm. The ships, being half a mile or more in length at the smallest and a mile and a half in the case of Warspite, needed to leave a lot of room in the formation to allow them to manoeuvre. Each ship was spaced at least two miles apart from its neighbours, yet with the ships moving at speed it was proving too close to respond in time to rapid course changes. The problem was added to by Manx’ own orders, as he tried to spiral the fleet through space so that he could use their own engine wash, the exhaust blasts, as a weapon. The corkscrew course was designed to twist and turn to relieve the direction of attack and so ships were moving en masse in the 3 dimensional plane, left, right, up, down but above all ever forward. The Thought-helmsmen had a lot to do just to avoid each other, let alone the enemy. Except for the Centurion. Captain Valeri Ugisako and his helmsman didn’t have such worries. Where he was heading, there were no Terran vessels to be concerned about hitting.

On the screens, Centurion reacted to the chaos caused by the Ironchild , veering away, passed the shattered hulks of Churchill and the de Gaulle, who had somehow managed to collide head on, towards the teeming mass of the enemy fleet. However, she was suddenly not alone. She was now joined by the Grim Reaper, which had already suffered severe damage, her forward hull baring a gaping hole in her name, painted in white letters 50ft high on the black hull. She was in bad shape, with more holes and fissures spread out all along her length. Her hull was seemingly held together by little more than will power.

As she hove into view, the All-Father checked his Thought-time, the numbers swimming into being for an instant through telepathic projection that only he could see, visible against the backdrop of the ship on the screen, who now appeared to be called the ‘G- Reaper’. 20:01, Earth Time. This would be recorded in the Thought –log as the time the Terminal ships were committed. But something else – the time he left the fleet, his fleet, to die whilst he fled. Still, it was as good a time to die as any. Better them than him, afterall. He glanced back up at the screens.

The Grim Reaper’s Captain had decided she was finished and launched the life pods for non-essentials, as those who stayed ran interference for the Centurion. It was four decades since a Terminal ship had been detonated and no one was quite sure what would happen. The Captain had a pre –buried thought code, activated by a signal from a Telepath, that he would recite, triggering a suppressed telepathic memory that completed the Thought-transmission to the atomics. When it detonated, it was called ‘Going Nova’. The only certainty was that you wanted to be far away from it when she exploded. It was a one way mission that ‘Grim Reaper’ now joined her on. The aliens seemed to perceive a threat and closed in on the danger, massing all over the hulls of the ships. The nearest Terran ships, the Julius Caesar, El Cid, The Count of Ourem and the Io Sunrise all stopped firing at the insects closing on their own positions and instead tried to intercept the creature-ships heading for Centurion. For a few brief moments they delayed the inevitable, sacrificing themselves in the process, but each moment bought distance between the fleet and the doomed ships, as they penetrated further and further into the heart of the largest enemy groups. But some deeds lie beyond valour. Grim Reaper was now engulfed, no speck of hull plate visible that was not part of a Deracon creature-ship as she and Centurion moved ever further away from the fleet. Still they ploughed on together, on through the insect waves like doomed brothers heading for the gallows, with Centurion now covered in a similar mass of the alien horde. They were both well beyond the support fire of the fleet now, and as Grim Reaper met her end she performed the last service she could for the Centurion, turning suddenly and hosing down its hull with the point-blank blast from her engines.

Captain Valeri Ugisako rolled his own ship in the hot flames, clearing large parts of his hull on three sides, buying them extra time to get into the heart of the enemy as the live ships were burnt off in their hundreds.

Grim Reaper finally imploded, her fragile innards finally pierced beyond salvation as Centurion pushed on, the creatures again massing all over her. She was finally lost to visuals on the Warspite as the aliens swarmed all around her hull, her once sleek shape becoming a ball of living insects, the tiny point of light from her engines in the distance finally being lost to sight as the creatures between the ships blotted out the view. As Centurion’s hull was breached her Captain, had already received the telepathic activation code from Warspite. He was vacuum-suited up in preparation for when the air would be sucked from the interior of his vessel, and had relocated ready for his final act as a Terran Order officer. He was deep in her interior, in the room housing the controls for the atomic devices, the ‘Last Chance Saloon’ as it was known. Like all good Captains, he knew his own ship, and he sat patiently, humming to himself the Empire anthem, listening to the thrum of her engines and the ever fainter ‘whup-whup-whup’ of her pulse cannons firing, fading as the hull was ripped open and the operators, the Thought-gunners, were killed. He could only hear a few still firing, then after a few moments only one, way down aft, low on the starboard side. Finally, it too fell silent. It was nearly time. He waited until the first alien mandible pierced the internal polymer bulkhead plate of the room he was in before he acted.

Captain Ugisako made the traditional Terminus broadcast to all fleet members, using his thought transmitter, a tiny stamp-sized electronic square implanted at his right temple that amplified and projected his mental presence, and was also synchronised to the atomic detonators by his own thought patterns so they could never be set off accidentally or if, like the Warlord, the ship was destroyed.

What better way for a man to die, than facing fearful odds?
Fighting before the houses of his fathers, and for the temples of his gods.
We go to greet the First Father
.”

The bridge crew of Warspite watched in silence as there was a blinding flash, followed by a dull ‘whump’ noise as the blast glass was hit by the enormous pressure wave.

The Centurion went Nova, and Val Ugisako went with it.

The multiple detonations of the atomics signalled a massive whiteout of the view screens, so intense that it lasted some 14 sol seconds. Warspite rode the wave, sustaining minor damage from the impact of the blast. Some of the other fleet members were not so lucky.

Millions of the aliens were vaporised and many of the survivors were scattered, yet still ever more were jumping through the Null Space rifts to take their place.

“Around half the enemy groups destroyed or scattered, some 50 or so groups left…still more coming through…53…58…61” the Scan Op had dared to hope the tide had turned for an instant, but now the inevitability returned to his voice. Each group that appeared numbered in tens or even hundreds of thousands.

Some 18 of the more crippled ships of the Order failed to survive the blast wave as acid and creatures were blown into their sides, the aliens’ bodies bursting open as they impacted to release the deadly liquid that ate away at the already damaged hulls. The ships of the Black Fleet were black for a reason – their hulls would absorb any light source, the solar cell paint that coated the fibre-glass-like polymer plates of their hulls supplemented the ships’ on-board energy, helping charge and power the guns. As the hulls were covered and the polymer plates destroyed by the acid the ships were losing their power as well as their structural integrity. Metal hulls had long ago been replaced by the much lighter man made materials. But unfortunately, those same materials were susceptible to the acid.

The All-Father looked at Admiral Manx for the last time. They exchanged the briefest of nods.

“The First Father will greet you all…” he said somewhat hollowly. Only the Spirit Caste member on the bridge smiled. Manx did not, but gave the sword-slash salute.

By the time they had reached the science deck, located deep in the heart of the ship, a journey of just 7 minutes, another 54 ships had been destroyed. Waiting in the Time Chamber were three members of each caste who were to travel with the All-Father. They bowed stiffly as he entered. Only the supreme Telepathic Caste member, known as the Reacher, blanched, as he read the true situation from the mind of Doctor Timon.

It was forbidden to read the All-Father. Their Leader stopped and surveyed them. Then he turned to the Doctor.

“There are Spirit and Political Caste members?” he asked.

“Of course, All-Father”.

“Unnecessary. I am the political and spiritual head of the Order”. He looked at the Science Guild members, the Worker Caste, Warrior Caste and finally the three beautiful women who stood heads bowed. The first had long blonde hair tied back in the Order approved pony tail, blue eyes and well- rounded breasts. High cheek bones spoke of her north European genetics. The second girl was shorter, with jet black, wiry hair. She was just as pretty but in a different way. She had been chosen for her intelligence as well as her genes and had bright obsidian coloured eyes that twinkled with knowledge. She was clearly of Indian roots. The last woman was classically Chinese in her looks mostly, her pale skin accentuating the redness of her hair. She had been selected for her mixed genetic make up. The three were of the Breeder Caste. The All-Father nodded approvingly. “Breeders?” he asked of Timon. “Why Breeders?”

“We may need to develop the genetic strains in situ, as a backup to building a second Chronos Drive in their time. Or, if …if you are isolated…First Father forbid it, … you may start the nucleus of our society centuries earlier than it developed. Which would still help us in this struggle. And it will give you something to do.”

The All-Father smiled. “There are Telepaths?” he asked Timon, who nodded.

“Good. Replace the Politicals and Spirituals with more of the other Castes. Especially Telepaths. You yourself are coming, Timon?”

“No, Sire. This day is my end. I must thought -operate the machine, as it is calibrated to my mind only , but the Science members are capable and have studied the information we have on The Angel. They will find her. It will take many Sol years but they will be able to build a passable version of the Chronos Drive. Once you have her help, she may even be able to build it faster. You will be able to return to this time with her and avert this disaster. One last thing though. The Chronos drive will deliver you to the time of the SGz6 probe, second decade of the 21st Century. You will be in the time when the First Father is alive, but merely an infant or a young child. Possibly before she saves him…”

The other Caste members murmured in surprise before a look silenced them.

“I could nurture him…” The All-Father mused.

“Not advisable, Sire.” The glance from the All-Father made Timon answer hurriedly “But it is your choice. I would suggest leaving his own principles develop initially, then, perhaps, you may guide him in adult hood. I was going to say it would be best if you watched him from afar, rather than direct interference. It may change everything we hold dear.
The co-ordinates are set, Sire. You will be sent to a place known as Metro City, we believe it is his home, as seems to be confirmed in the Sacred Journal and by the Fore Father’s knowledge. It is where the Angel abides and where she saves him. You will need these re-breathers as the air is too pure for us. They will give you the appropriate chemicals and toxins to allow you to breathe there normally until your body gets more used to it. Long term, it is recommended you purchase sticks of tobacco weed that you may burn and inhale; this will help suppress the natural urge to cough in the clean air. The shimmer suits you have will mimic conventional clothing of the time. The device will send you back in threes, a Sol minute apart. I will select the replacements in the last two transmissions and provide the barter currency. We understand gold is of value. And small plastic rectangles.”

“Gold? Why gold?”

Timon shrugged. “It is an era that pre-dates the discovery of Midas, I assume.” He said. Midas was an asteroid with a huge, solid gold core, that had been extensively mined. Though not terribly pure in situ, it was easily refined. Many of the Empire colonies had extensive reserves of precious metals, making them far less precious.

“No matter. Choose the personnel well, Doctor. You have done the Order a great service. Transmit the Chronos Drive details to all other ships to relay to Earth. They may yet be able to perfect it, and improve upon it.” The Doctor nodded.

“One last point. You may need this.” Timon handed the All-Father a strange, small, round device.

This time, it was the All-Father who nodded agreement. “Let us hope not.”

On the bridge, Manx realised that the energy pulses for the time drive would delay the charging of the Null Space engines even further. It was effectively signing the death warrant for all on board. He had thought to raise the issue with his leader, but the chief telepath, the Reacher, had warned him against it, mentally. He had thought to save at least half the fleet if they were allowed to jump but staying would condemn them and most of the fleet to destruction, as the ships capable of jumping would have to stay to protect them for as long as possible. But the Reacher had pointed out that half the fleet would not achieve victory, when the whole of the fleet had already failed. It would but delay the end. This way, with the Chronos time drive, they could actually achieve a decisive victory and avoid this fate. If they delayed using it now, jumped and more Deracon were waiting for them at the arrival point, they would not have the power to utilise the Time Drive at all. It was now, or maybe never. It was a reasonable argument. But then the Reacher was going back with them. Manx was not.

As the Time Party were despatched in successive groups, all around Warspite the battle was in its closing stages. Some ships too distant to aid the flagship, had managed to jump into Null Space and were making for the Acheron Station rendezvous in line with the withdrawal order. But most obeyed the order to protect the flagship whilst others, like Warspite, still had their jump engines charging. For them, this, the Battle of the God’s Eye Nebula, would be a last stand. The Deracon race would know this battle by a simpler name – ‘the Place of the Killing’.

True to their crews’ vows, the surviving ships of the Order moved to form a screen around the Warspite, unleashing their last weapon – a barrage of nuclear torpedoes, fired in all directions. They were fired long range and the multiple blasts exploded deep within the heart of the waves of the enemy, tossing the tiny alien ships ahead of the blast wave and expanding to engulf huge quantities of the Deracon within the fireball. The vessels of the order braced against the impact riding out the turbulence like the sea ships of old Earth, before The Fall.

The barrage went on for several minutes as many hundreds of warheads were loosed from the vessels still able. The leading waves of the aliens that were overwhelming the outer ships of the fleet were scattered by the energy blast, as were some of their victims. When the last of the atomics exploded and the blast cleared, huge holes gaped in the ranks of the enemy. But such was the nature of the bio ships that many had simply ridden the wave, impacting against the hulls of the Earth ships, their acid weapons eating through the hull plate even as they were destroyed. Others were simply blown off into space, undamaged. But many of the others had linked to each other, forming vast rafts that were better able to ride out the blasts, there being safety in numbers. They were carried for some distance but not as far as individuals. When the explosions dissipated they simply re-deployed. When the Scan Op thought-linked to the computer for his readings, only some 40 % of the aliens remained. He was euphoric as he relayed the news, sensing victory after all. But still the Null Space rifts formed all about them. As the creature ships regrouped to come again some of the damaged fleet were able to jump. The smaller, less diversely armed ships were able to recharge the jump engines much faster than the larger warships as they had fewer offensive systems that needed the power. Manx was left rueing the fact that they still needed some 34 more Sol minutes to escape themselves. The Empire ships fought on.

Yet Manx had bought the time the Doctor had needed. When the Hive Mind colony ship emerged from Null Space half an hour later, dwarfing the remaining two hundred or so Terran vessels that still remained, its four hundred mile frontage filled all the view screens on three sides of Warspite’s command bridge. It was too vast for the screens to render a 3D image and many shut down in error.

The 3D map board shrank the Earth fleet in scale to mere dots to fit the monstrous vessel in. Manx had never seen a Null Space rip like it and never envisaged a ship could be so big. The reality was, it was not one ship, but 18 billion smaller ones. Its scale made the Earth vessels look like…well, insects.

At least it answered the question that had been bothering Manx from the start – how could such small vessels travel through Null Space. The answer was simply that they were carried and then dropped off by ships such as the monstrosity before him.

When it arrived, the end came quickly. But for another 2 minutes Manx and the Warspite may have escaped. But they didn’t last that long. The Mother of Voices gave a last burst of defiance but the creature ships were so densely packed that the sonic blast was absorbed by the bodies in the outer layers. They fell away from the Hive Colony ship in their tens of thousands, stunned or destroyed, but there were so many others it had little effect. It was little more than one last scream of a fleet in its death throes. Manx and what was left of his fleet went to the First Father knowing they had done their duty. It was little consolation. In all, around 187 ships had managed to escape to Acheron Station. All but 16 of them were badly damaged. There were no survivors amongst the ships that stayed. They didn’t know that the colony ship that engulfed them was just one of fourteen such craft that the Deracon had.


In a disused warehouse on the fringes of the industrial district of Metro City, a flash signalled the arrival of the All-Father, flanked by two of the Warrior Caste, heavily armed. Two other warriors and the Reacher were already there. He looked around with disdain, as a minute later the third trio arrived, a telepath and two of the scientists. Everyone was wearing a re-breather mask as they were unused to the lack of pollutants and a shimmer suit. Shimmer suits were a silvery-metallic hooded bodysuit that was thought-linked to its owner, that could project the image of any clothing type onto the wearer that they could think of. It gave the illusion of dress. The All-Father stepped forward.

“So this is the 21st century….” He looked at the bare walls of the grim surroundings with obvious displeasure. “Oh well…I’m sure it will be nice when it’s finished” he said drily. He turned to the telepath as the fourth group arrived. “Find her. Find the Angel. NOW. If she does not come willingly…” he turned to the two warriors “you will bring her here.” They exchanged a nervous glance.

“But… she is the Angel, All-Father…How can we subdue her? Why would she refuse to help us?”

The All-Father handed them the object that Timon had given him. “If it is unavoidable…use this.”

He turned to face the Reacher. “When you make contact…find out what you can. We may need to find ways to control her, or influence her.”

The Reacher was surprised. “As the Warrior, Elgin, said Lord, why would she not aid us?”

“You are not witness to the Fore Father’s wisdom. You know what is in the Official version of the Sacred Journal. There are other references about her…and the media scans from the time probe would seem to confirm it… she may have different ideas to our own…” he answered awkwardly.

“All-Father?”

“She may need persuading to help us. And if persuasion fails, too much is at stake to simply give in to her wishes.”

“But she is The ANGEL, Sire…the centre of our Faith, the saviour of the First Father!!! A Goddess!!! It...it is inconceivable that she would let us die, see our world destroyed!” the Reacher was aghast at the prospect.

The All-Father smiled. “Do not worry. Any of you…” he addressed the assembly, who showed obvious unease at this news, looking around and smiling reassurance. “Of course, she will help us.” He paused as his words had the desired effect and several present breathed an audible sigh of relief.
“One way, or another.” He added.
Last edited by tallyho 12 years ago, edited 1 time in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

Apparently our heroine will have some trouble ahead
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Cool stuff T, intersting to see what happens when SG and the time travelers meet. Great work.
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
DrDominator9
Emissary
Emissary
Posts: 2486
Joined: 15 years ago
Location: On the Border of the Neutral Zone

Re: Supergirl and the Last Human

The futility of the battle in the future certainly sets up the importance of SG's response in the past. I look forward to seeing how it's handled.
Follow this link to descriptions of my stories and easy links to them:

viewtopic.php?f=70&t=32025
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Part 4

On a dark desert highway….Hey Brown Eyes!” the café owner called to Kara with an infectious smile, interrupting his rather appalling version of Hotel California. By his own admission, his singing could be likened to a dying guy screaming in a minefield.“You come to finally propose to me, then?” he said with his lilting Welsh accent, as she smiled back.

“I thought you weren’t the marrying kind, Rob? Free spirit and all that?” she frowned back at him.

“I’d change for you” the middle aged man replied wistfully. “Usual?”

“I wouldn’t have you any other way. Yes please, milk and two.” She liked coming here, largely because the owner, Rob, was so gregarious. He always made a fuss over her and the other clientele as if they were special. He was lewd and crude and often very rude, but he was impossible not to like. He’d run the T42 Tea Shop just off campus for 8 years and knew pretty much everyone. Ironically, given her intellect, she had thought of it as the ‘T Forty Two Shop’ for the first few visits until the name had sunk in. She had to admit it – the logical order and thoughts of her Kryptonian brain meant she just struggled to think laterally the way humans did. That was why she was no good at using metaphors, similes and euphemisms. Innuendos usually took her a while to get too. ‘Oh well, nobody’s perfect, not even me’ she thought jokingly to herself.

Rob set her tea down in front of her and tried his luck again as she removed a book from her backpack. He paused staring at her intently, until she looked up at him, raising her eyebrows in an unspoken question.

“What would you say, if I said….’I gotta go now sir, I gotta meet a man at Marwar Junction….’?” He looked at her expectantly.

She paused a moment pretending he had her. She could see the excited expectancy on his face. “I… would say…that you’ve been watching ‘The Man Who Would be King’” she said with a sly smile of triumph.

“AWWWW GODDAMMIT!!!” he shouted with a pained look on his face as she guessed the film quote correctly. It was a game they played, challenging the other to guess the quote. She had a massively unfair advantage of course but she threw him one every now and again, pretending not to get it. But not today. “You’re too sharp for me , my girl! “ he declared, shaking his head and rubbing the already spotless counter vigorously with his cloth.

“Jeez Rob, you’ve had 3 days and that’s what you come up with? Why didn’t you just say ‘Who’s Kaiser Soze ?’ and be done with it.” She smiled, mocking him gently. He seemed genuinely hurt at her jibe.

“Hey, it weren’t that easy, my girl.” He said defensively.

“Sure, it was right up there with ‘We’ll need a bigger boat’ and ‘You come to me, on the day of my daughter’s wedding…’ “ she did a bad Brando impression, complete with hand gestures. With her refined hearing and superior vocal control from her Kryptonian background , Kara could have actually done a perfect rendition, but she deliberately shied away from such things in her alter ego as Linda. A low profile was better.

He laughed, an embarrassed sort of chuckle, and blushed slightly. His round, red cheeks going darker.

“It’s in my top 20, so don’t feel bad.” She told him with a smile of her own. She hoped he wouldn’t linger today, as she needed to think.

“Why won’t you marry me, Brown Eyes? What other man in town could offer you what I got? Ok, it’s more chins than eyes, but some people like the fuller figure…” he was plumply overweight but saw it as an asset. Both knew he wasn’t serious.

Kara smiled. “The tea will do fine, thanks Rob” she had a lot on her mind and could do without his distractions today, however light-hearted. Luckily , at that moment, two female undergrads walked in. Rob turned to serve them with his own inimitable style.

“Ladies! Why date these college kids when you could have me, a real man? Ok, it’s not very big, but I got 16 stones of weight pushing it in…”

Kara nearly choked on her tea. As her coughing subsided she laughed in spite of herself, then turned her attention to the matter in hand. She had retrieved the pieces from the destroyed transmitter but had learned remarkably little. Some elements seemed far in advance of today’s technology, but some seemed almost backwards in both their design and, as far as she could work out, function. There seemed to be a production stamp of sorts – a highly stylised EE overlapping each other, the central bar of the upper E making the top bar of the bottom one, in a shield with PPN below it in a scroll. It was laser etched into the metal and sprang up as a 3D image when angled to the light. It appeared on several surviving pieces of the device. But what that meant was anybody’s guess. She needed time to think and so she came here. 'She is of this time' the light message had said. That could mean that whoever was being searched for was in danger – but without knowing more she could not hope to find or protect them. Were they searching for her? Possibly , or was that just arrogance on her part, thinking herself special enough to be sought after, presumably due to her abilities, more so than any other human female?

On the TV in the café, a bizarre story was reported of an event yesterday. Apparently three identically dressed lumberjacks had tried to buy a packet of cigarettes with a solid gold bar. Murky CCTV images showed the three as they panicked at the shop keepers reaction and fled, leaving the bar behind them. The bar was apparently not stolen, so police were looking for them only with a mind to returning it. Current gold prices set its value at around $84,000 dollars. The shopkeeper was being praised for his honesty. But she had more urgent matters on her mind.

A few days had passed since the incident and she was none the wiser. Why were they hunting whoever it was? That really depended upon who they were after. Without more information she could not hope to reach an answer. She had searched for other devices, all over the oceans of the world but found nothing. No re-occurrence of that feeling of unease from the other night. She decided to begin a land based search this evening. If the device was some kind of searching unit, logically, with an entire planet to cover, any further devices would be spaced well away from it for maximum coverage. She settled on a course of action; tonight she would look at Russia as a possibility, then Australia, China and Europe. Over the next half hour she weighed likely candidates for the search, areas remote but still accessible to satellite broadcasts. As the device was monitoring media output, she assumed it would need somewhere flat, few hills, sparse population. She would start with the Steppes of Russia tonight. Although the other device had been at the bottom of an Ocean Trench, so perhaps she was on totally the wrong tack after all.


She glanced idly at a flyer on the table advertising an English lecture, featuring the ‘Master of all things Literary, Gary Hudson'. She had to admit, she was intrigued by the epithet. But suddenly another thought crossed her mind. But it wasn’t her own.

'Angel.'

The voice seemed almost in her ear and startled her. She looked around sharply to find two young guys at the next table staring at her. The taller one seemed to have only one thing on his mind. She tried her best to look dowdy in her alter ego of Linda but even with drab clothes and limp brown hair her face was still naturally beautiful on closer inspection and still some guys came on to her. She dipped her head hurriedly as she met their gaze.

“Oooo, she’s shy” one said to the other. The taller one smiled.“Kinda cute though, in a plain kinda way. Bet ya five bucks I can guess what tea you’re drinking, honey.”

The tea shop had a wide range of teas from all over the world, which was why it had done well catering to the academia of the university faculty, as they didn’t need the caffeine, though most of the student body went to Starbucks.

“I aint got five bucks” Kara said, utilising her best teen bad grammar, hoping he would leave her alone. “I only got two. Please I just want to read my book.”

“Leave her alone, Rick.” the shorter one said. But Rick was having none of it,

“Ok, two then. Just $2 bucks. Then I’ll let you alone. How about it?”

“Fine, if it’ll mean you leave me in peace, ok?”

“Ok, bets on, here we go” He ran his eyes over the menu of exotic blends behind the counter, intermittently looking back at her. “You got a classy kinda look to you…I reckon you arrrrre…ssssome rich guys daughter…now you dress that drab way just to piss off Daddy…grew up with nothing but the best, so something exotic…Earl Grey is waaaaaayyyyyy toooo common for you…so I reckon either ….Darjeeling or ….Assam? I reckon its Assam.” He turned to face her, a lascivious smile on his face. It was pretty obvious he didn’t give a damn if he was right or wrong it was just a means to an end for him, the end being talking her into bed by the looks of it. His friend just looked embarrassed.

“Rob,” she called, “Guy here has bet 2 bucks that I’m drinking Assam.”

“Yeah, I heard the bet. 2 bucks on Assam? The wise 2 bucks woulda gone for plain old English breakfast tea. Simple gal is Brown Eyes. Likes simple things. That’s why I love her so.” Rob smiled at her as he wiped down the counter and winked happily.

“Well, ok, we’ll call it a draw. So ‘Brown Eyes’, was I right about the rest of it?” the jock said with a grin. He seemed under the delusion he was being charming.

“The deal was you’d leave me alone” Kara sighed.

“Aww, c’mon, you can’t blame a guy for….”

'Angel.'

His words faded into the background as this time she heard the word clearly, or rather felt it clearly, appearing in her mind like a thought. But not one of her own thoughts. An invader, of sorts. She looked around suddenly as the guy droned on with his spiel.

She was waiting for it when it came again, her attention focussed, ready to take in all that she could from the experience.

'Angel'. It felt like…a consciousness reaching out to her … there was a need, a desperation behind the simple word. Ignoring the goings on around her in the café completely, she decided to try an experiment. With conscious effort she thought 'Do you mean me?'

'Angel. …You...are…many….Kara…Linda…Supergirl…all are you…all are the Angel.'

“I-I’m no Angel” she said out loud, shocked deeply that someone knew her identities and could seemingly read her mind. Realising her mistake she stood quickly to leave.

But the guy stood up to block her path. “Well, I ain’t no saint either, sweetness…” he said with a lecherous grin as he held her by the arm.

“Hey-hey-hey-hey!!!! Sit down, good boy and stop bothering my customers, or I’ll drop you quicker than I dropped third period French…” Rob came around the counter with a speed that belied his slightly chubby frame.
“You don’t have to go, love. These gents was just leaving.” He said.

“Oh, really? You gonna make us, fatso?” the taller one snarled. He seemed to have reacted badly to being ignored by Kara for the last two minutes.

“Rob its fine, I-“ she started, not wanting a scene, but he waved her quiet.

Rob sighed heavily. “Fatso? That’s what you got for me? Fatso? What are you reading son, a degree in poor insults? 65 million years of evolution have gone into making you-“ he flicked his fingers up and down to indicate the length of the young guys body dismissively-“ and that’s what you come up with as an insult? You call a moderately fat guy, ‘FATSO’? And you are going to be in the top 20% of educated people in this country? Don’t make me laugh, boy! You got college drop out written all over you!” he burst out laughing as Rick went bright red, as even his friend smiled and several other customers sniggered. Rob’s smile suddenly vanished.

“I spent 3 years in Hereford, good boy. Ya know, Hereford, England. Where the SAS barracks are based.” He said cheerfully.

The young guy looked at him with derision. “You sayin’ you was in the SAS?” he said with a laugh.

Rob stared at him coolly. “No, of course not. We’re not allowed to talk about our time in the regiment…Fat guys weren’t always fat guys, son. You’ll learn that , once you grow up an’ start shaving. And forty- two year- olds were twenty- two year- olds once. And I ain’t run a tea shop forever. Now this plays out in three ways. One, you leave. Nice. Tidy. Everybody’s happy. Or, I’m full of shit, we fight and you win, in which case I just get the police , press assault charges and you’re kicked out of Uni. Or the other alternative…I’m actually telling the truth and can snap your back like a matchstick in eight different ways…” he said confidently, never taking his eyes off the younger man, who had a good four inch height advantage over him. “So…what would Jesus do?”

Long seconds passed. “Rob, its ok, I was going anyway” Kara said, trying to diffuse the situation whilst working out what she would do to finish it quickly without hurting anyone, but the owner just stood there smiling affably at the two guys. But the smile never touched his eyes, which were cold and watchful, like a shark’s.

”C’mon, Rick, this aint nothin’, lets blow” the smaller of the two pulled at Rick’s arm, who shook him off angrily.

Direct action was out, so Kara decided on the most benign thing she could think of. She used her heat vision to start heating up Rick’s big toe.

As the heat rose and became uncomfortable, Rick frowned, a little bewildered and shifted his weight. Rob remained unmoving, arms folded, seemingly at ease. Kara kept her head down, ostensibly avoiding confrontation but actually giving Rick a very mild and very small burn.

“YYYYYYEEEEEEEEEOOOOOOOOWWWWWWWWW!” He suddenly cried and starting hopping around, holding his foot and then almost falling over, much to his confusion and everyone else’s.

His friend, just as bewildered looked pained, mouthed ‘sorry’ to Rob and Kara and tried to pull his friend outside. Rick shook his arm off. “C’mon man, wassa matter with you, dude? Lets go.”

“I fucking stood on a nail or something! Fuck this. Let’s go to Starbuck’s. Coffee is shit in this joint anyways…” Rick said, sulkily, embarrassed and limping. “She’s probably a dyke anyway…”

“Oh, classy boys, real classy.” Rob jeered. But the commotion had awoken a sleeping beast in the back of the café.

R.V. Jones, Rob’s aged Springer Spaniel, waddled in from the kitchen wagging his tail slowly as he sniffed the air. Each wag took 4 seconds. He was so ancient he moved one slowly padded paw at a time, just a few inches forward with each step. Going anywhere took a long time for R.V. Jones. He moved almost like a woolly clockwork toy, and his progress was strangely mesmerising to all in the café. All heads turned to him and watched as he slowly made his way in between the warring factions, padding ever forward with a slow deliberateness. It took him around 45 seconds to traverse the 5 feet from the store room door to his owner. He managed to make traversing a flat floor seem like he had conquered Everest. There was almost a collective sigh of relief when he reached his destination and looked up at his master. “Where the hell were you?” Rob said, “You’re supposed to be a bloody guard dog… you’re less use than Spartacus!” he jerked a thumb at his tortoise in a large tank behind the counter. Spartacus was in his usual pose, head in, legs out. There was a rumour he was dead. R.V. Jones was possibly the only creature slower than the reptile. Rob sighed as he chastised his dog. “You….I dunno….you’re useless Harvey, useless.” The baleful Spaniel eyes did their usual trick, and any anger Rob felt dissipated. His dog looked at the departing duo indifferently, stretched with a yawn and then nuzzled Kara’s leg softly with his wet nose, oblivious of his failings. She patted him affectionately as she kept her eyes on the two freshmen. As a guard dog, ‘Harvey’, as R.V. was known, was about as much use as a Kardashian sister.

The two left, and as they slammed the door behind them Rob called “Thanks boys! Come again!”

“You were in the SAS?” Kara said incredulously to him.

“Don’t be so bloody daft!” Rob answered with a laugh. “Brown Eyes, you’re lovely, but you’re gullible. Look at me, girl.” He gestured at his portly frame. “I aint seen my feet in ten years! I was a painter and decorator when I was 22 and I was only 5 when I lived in ‘ereford. Weird the way he stubbed his toe like that though…” he said pensively, looking around for the mythical nail on the floor, before he shrugged.

She smiled. “Thanks, Rob. They were harmless though, it’s just I wasn’t in the mood. I really do have to go, though.” She gave him a peck on the cheek.

Take me, I’m yours!”
She laughed as he burst into the rest of the song.
“Because drrrr-eeeams are
made of this!
Forrrrr-ever
there’ll be-ee a
heaven,
in yourrrrrrrrrr kiiiiiiiiisssss!
” he twirled on the spot and spread his arms wide to wrap her up in them as she fled to the door.

“I thought you Welsh guys could sing?!!!” she called mockingly over her shoulder as she winced.

“Nah, we just get drunk a lot and think we can sing. Biiiiiiig difference.” He smiled. “You know you’ll be mine one day, Brown Eyes! No gal has resisted me forever! Well, apart from all those ones who have.” He said almost absently to himself. He patted his ample belly with both palms. “This body could be yours! Body of a God under these overalls! Just happens to be Buddha, is all. You know I like to stay in shape. And ‘round’ is a shape. Go to the gym every day. Just look at the female aerobics classes mind, but it’s the thought that counts.” He winked at her.

Laughing, she left, though as soon as she was out of the shop her smile faded as she tried to make mental contact with the strange presence she had felt. This time she would really keep her thoughts to herself.

'Are you there?' she thought.

'Angel… We… need you…We need… your help… Come to us… Come quickly.'

'Who are you? Where am I to go? How will I find you?' She thought. After a moment the voice inside her head answered her.

'We will …explain… in due course. Come to us… I will guide you… I am the Reacher…our world… is in danger…'

'What world, what danger?'

'It is this world…you must help us… to save it…'

'This world? The Earth? In danger from whom? How?' she asked.

'It is not a ‘who’…it is a ‘what’. We need your help… it’s about time…'

'But you have only just contacted me! It’s abo-? Oh. Oh I see. Ok. I’m on my way'

'I will guide you …give me a moment.' The thought-voice stated.



In the warehouse, the Reacher beamed at his leader, though the re-breather mask hid his smile. “She comes! We are saved!” The in-built microphone allowed his voice to be heard clearly. “Her mind is…strange…very complex…I could feel several personalities. This Kara which is her true self, the Angel of course, or as she is known in this time Supergirl, a ’Linda’ which I do not understand the significance of…and there seemed another presence, almost hiding from me…” as he spoke those words another nearby telepath dropped his gaze and stood back further amongst the crowd. “Her mind…seems alien to me…almost inhuman…”

“She is a GODDESS!” the All-Father said hurriedly,”Did you think she would be as us mortals? She is the epitome of human evolution! We, lowly beings who have regressed since the Fall, cannot hope to understand her!” he snapped at the chief telepath.

The Reacher looked suitable abashed. “Sorry, All-Father, a foolish notion of mine. But she comes to us, even now I am guiding her! We are saved!”

“Not yet. She has to agree to help us” the All-Father answered sternly. He turned and glowered at the shamefaced trio before him.

“You were supposed to keep a low profile! You are on every visual frequency that serves this city!!! “ He shook his fist holding the media orb at the three before him. “Why did you not take a telepath? He could have read the thoughts of the store owner, determined what was needed.”

“B-but All-Father, you sent us!” one of the two warriors stammered. The scientist and the other warrior caste member who had failed so dismally to procure cigarettes had enough sense to keep quiet.

“IS IT NOW MY FAULT ?!!!!!! THAT YOU THREE WERE TOO INCOMPETENT TO OBTAIN THE TOBACCO STICKS?!!!”

“N-no All- Father…”

He looked around at the others, all dressed in red checked shirt and blue jeans, with steel toe-capped boots. “CHANGE, YOU QUELG!!!!” he shouted, likening them to the dumb race of tripedal simpletons that were the original inhabitants of the Prospero planetoid. The Empire had tried to use them for menial tasks after their world ‘joined’ the Empire but they had proved useless at almost everything. Their name had become synonymous with stupidity throughout the Empire. They had been the only vaguely civilised alien race they had encountered that was not simply an animal. But they were little better in the eyes of the Empire.

The shimmer suits picked up on the thoughts of the wearers and morphed into the more varied and conventional styles that they had now seen via the media orb. Fierce looks flashed at Vishan, who had seen a construction worker outside on the first scouting mission and advised all others to copy the clothing his suit mimicked.

Then the All-Father spotted a familiar face at the back of the group; he stood out as one of the few with his mask still off. “Timon! You made it!” he called with genuine warmth and delight. He strode forward to embrace his friend, arms outstretched.

The figure he addressed looked around at the others in bewilderment. Then he realised that the leader meant him. He replied nervously, “N-No All-Father, I am Chhengri, but we do have a 99.99% genetic match, a common ancestor. Timon stayed. Timon is dead.” He dipped his head in reverence.

With genetic strains valued and engineered for superior qualities, many of the Empire’s inhabitants resembled each other. Normally the shimmer suits displayed their name to avoid confusion.

The All-Father glowered at him, then turned away angrily. He pulled off the re-breather mask and they all followed suit. As they tried to acclimatise to the strange tasting air they were wearing the mask for 15 minutes, then leaving it off for another 15 and so on. He hated this place and he hated this time. He hated what he might be forced to do, to gain the Angel’s co-operation if she would not agree willingly. Even the sustenance pills they had brought didn’t taste like food in this awful period, because of the fresh tang to the air. With no beds they were relying on sleep injections for rest, slumping upright against the walls in groups until the injections wore off after around 6 hours. He still felt keenly the loss of the fleet, and that they had been reduced to this desperate gamble. But above all he was worried about confronting the Angel herself. Hard to believe a few days earlier he had viewed her as a myth. Now, all his hopes at restitution rested with her. As the spiritual head of the Order, he knew the truth of her as a ‘Goddess’. She had special abilities , no doubt , but the whole ‘Angel of the Elements’ concept was just to help give the people something better to believe in, a state figurehead to replace the ridiculous, ancient concept of an invisible man in the sky who would put the world to rights. At least she had some recorded history from the few records that survived before The Fall. He hadn’t really believed himself, but now he had had a chance to read the media of this time, and she was everywhere, every few days she seemed to appear. She could fly! Had incredible strength, a heat vision and a freezing breath! It was all true. He doubted from what he knew of her if she would help them. So he had taken precautions to control her. There was Timon’s device, yes, that would help, but it may not work. Poor Timon. So he had wisely taken other measures. He looked at Jaeger, another telepath. But one that he had assigned a very special task, unknown even to the Reacher. He raised an eyebrow minutely in an unspoken question as he looked at him. Jaeger paused as he made mental contact with the two warriors who were not in the warehouse but on a mission. As he looked at the All-Father he smiled and nodded, ever so slightly, an act missed by all.

A moment later Kara entered the warehouse, having quickly scanned the inhabitants from outside. She was now in her full regalia as Supergirl, having changed quickly behind Rob’s café, out of sight from the public. Some twenty or so individuals, of varying ages, mostly Asian in appearance, with one patriarchal figure that hey all seemed turned towards. Listening to their conversations from outside, they seemed to speak the same strange mix of Chinese-Hindu-English that she had encountered with the probe message. That seemed to settle the matter then – they had been looking for her after all. She stepped inside and waited a moment as the majority of inhabitants were turned away from her. Gradually all fell silent as one by one they turned to face her. She was slightly apprehensive, and whilst there was no tangible threat she tried to keep on her toes, alert and ready for anything. But she had no answer to what happened next. Almost as one, the group crouched, prostrating themselves on the floor towards her, kneeling, arms outstretched , palms down. She half expected someone to say ‘We’re not worthy’.

“WHOA!” she said stunned by their response.

Only the elder figure stayed standing, facing her. He wore a silvery suit with a single purple cloth draped around his neck to his waist, like a priest’s vestments. He was balding, with a soft, kindly face , like a beloved grandparent. He approached her arms outstretched in welcome, his eyes twinkling. He seemed immensely relieved to see her.

There seemed an awkward pause whilst he thought of what to say, a slight look of confusion on his face. Finally he echoed her reaction. “WHOA!” He said, seeming to think it was a greeting. He adjusted a small circular dial at his throat and then spoke clearly in English.

“Angel! Oh, sweet Angel! You have come! We will be saved afterall! You are all that the Holy Journal described! Say you will help us! Please, I beg of you! Promise me you will protect and save my people!”

“I-if I can…” she stammered as he embraced her.

He turned and addressed the flattened gathering at her feet “She has AGREED!” He shouted in the Chinese-Hindu-English tongue. “ She will help us!”

The people rose as one, with excited cheering and clapping, a gaggle of voices as they all spoke hurriedly at once to each other.

‘OHHHH HECK…’ Kara thought to herself. She had been here for just two minutes but things already seemed out of hand. The people around her formed orderly rows and then started to sing some sort of Anthem, all the while grinning at her in delight. The words didn’t mean much to her and she wasn’t really listening, but waiting for the patriarch to explain, so the group were halfway through the rendition before she realised they were singing it in her honour. They stopped suddenly and looked at her expectantly. After a moment she realised they wanted some sort of reaction so she smiled and nodded and applauded politely.

The patriarch addressed her once more. “I am the All-Father. We are from you’re far future. We need your help to save this planet, to save the human race…”

‘Ohhhh hell!’ she thought to herself. ‘Why was it never anything simple?’

“OK.”she said politely nodding. “That’s kinda my day job…” she smiled but the All-Father looked at her earnestly. He didn’t seem to think it a matter for amusement. He was absolutely right, she conceded to herself and became serious.


“We , who you see before you, may be all that is left of our species. The last of the Humans…” he said dramatically. He seemed to await some kind of response from her.


She, unfortunately, had no idea what to say to such a statement. “Oh, dear. ” she finally said, fully conscious of just how inadequate that sounded.


He looked somewhat deflated by her response. She felt embarrassed by it too. She then added quickly “Well, if I am going to help you, you had better tell me what’s going on…BUT I can’t guarantee anything…”


“Yes…let me explain…” he began, as the others gathered about him like eager children. He stopped, looking at them uncertainly.” There is wisdom from the Fore Fathers that is not for your ears” he said, and the disappointment in the room was tangible, though no one said anything, they just seemed to accept it, moving back to again stand in their ranks.


Almost military’, Kara thought. As the All-Father began to fill her in on the next 750 years of human evolution, for the first time she began to feel uneasy. Part of it was the actual tale she was hearing from the aged patriarch, but there was something else, something …sinister.


She felt as if she was being secretly observed, but strangely it seemed like the viewer was inside her somehow, looking out on the world through her eyes. It wasn’t the Reacher, who had been present earlier…it was a different presence. A harsher, crueller, more ruthless presence. She didn’t know who or what it was…but it was a rare occasion that she felt like this. She was nervous, yes, and obviously the experience was unsettling, but more than that, she actually felt afraid, afraid of the unknown.


Some distance away, Jaeger stared at her. He was the best Mind-miner among the telepaths, able to enter undetected, even by the Reacher, who was himself the best searcher amongst them. The Reacher was good, finding her in the first place and then learning of her multiple identities. Something Jaeger was not as skilled at was seeking out specific minds. But once inside, Jaeger was better. He could find secrets. He could find weaknesses. And he had.
Last edited by tallyho 12 years ago, edited 2 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Another nice chapter T!

Liked Kara's interactions with the tea shop owner, and her meeting with the Last Humans. I've got a feeling they might not be pleased when they figure out she's not human. Plus the mind reader found a weakness but which one I wonder?

Keep up the good work looking forward to more.
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

The chapter is going very well, I'm eager to know what will happen next when they find out the truth
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Part 5


Kara listened with a growing sense of disquiet as the All-Father told her of things that were history in his life but had not yet come to pass. Part of it was the unsettling feeling of being observed that seemed to come in irregular intervals, part of it was the disturbing version of the future he was portraying.


“Some thirty or forty sols – sorry, years from now “ he corrected himself for her benefit before he continued, “the Western powers are hit by a plague. Lehrmann’s Disease. No-one knows how it started, whether it was a genetically engineered weapon that was unleashed or simply escaped the lab conditions is unclear in my time. It can lie dormant for decades but its effects are usually fatal, in 90% of exposure victims. There is no cure. Survival is random. Survivors are sterile, their immune systems severely debilitated. Carriers are denoted by small circular bruising to the lower arms. It is prevalent among Caucasians and Negrans alike, though Asian genetics have a higher degree of immunity.”


“Negrans?” Kara asked unsure if that was some kind of race that Earth had met.


“Coloureds. African Continentals.” He explained. “ To us, in our time, Negrans. Two thirds of the Earth populace of your time are destroyed over three decades. There is chaos. There is war. There is a saviour. The Second Father.” He paused dramatically for a reaction. All Kara could offer was confusion.


“The Second Father?” she asked quizzically. “Not the First?”


“Indeed. The son of the First Father, who’s ways and teachings are recorded in this, The Holy Journal.” He brandished the aged book that he held. ”He is a boy now, in this time. A boy that you will shortly save. You make a lasting impression, that stays with him all his life. You are a symbol of purity and honour, the pinnacle of human evolution. Ideals that he will embrace and pass on. To the Second Father.
For with your abilities, it is clear you must have been genetically created as you and your brother are far in excess of normal man.”


“My broth-? Oh you mean Superman? He is my cousin, not my brother.” Kara interjected.


“Forgive. Few records survive from before the Falling of the West…”


“How is that possible? There are countless databases, libraries, mobile devices like cell phones, tablet computers and e-readers yet there are few records? How?”


“When the wars start, in three or four decades from now there are – “ he turned and raised his voice “Timon! What are Stat P’s known as in this time?” he called out to Chhengri.


“Timon is gone, Sire…”


“I KNOW, JUST ANSWER THE QUESTION YOU FOOL!!!” the All-Father suddenly bellowed, making the scientist jump and surprising Kara with his anger.


“E-E.M.P.s, Sire…Static Pulse weapons in this time are known as Electro Magnetic Pulse weapons…” Chhengri said falteringly in the ChEngdu-ish. Kara caught the English phrase and was able to decipher the Chinese-Hindu part as Chhengri wore no translator.


“Yes…thank you. Forgive me, it has been a hard time for us…” he said apologetically to her. “Yes E.M.Ps and more advanced data destruction devices destroyed the databases. Anarchy, riots and bombs destroyed the conventional paper copies. Most armies were heavily dependent upon war-droids. The pulse weapons negated them, but destroyed everything else too. Shielding just meant stronger weapons to defeat it. It took decades but ultimately, there was little left but partial records.
Paper books were often burnt as fuel. Ironically, the older the records the more chance they had of surviving. The very ancient texts, the classics as you know them. But little contemporary teachings.
That’s why the journal of the First Father’s teachings is so prized. It survived! Surely a divine sign of the way forward! The Second Father founded the Order, the Terran Order, as a means to restore belief in the shattered society. He embraced the old ways, old teachings, the sense of right that existed before the disease, before the decadence of this time. He looked back to the Knights of old Lore to restore order. But he knew too that purity alone was not the true answer. Darwinian concepts were embraced. The best will survive. Take the best of all mankind, of all races and use those traits to make a better species, a better human being. It took centuries, and the triumph of the Order in the Eugenics Wars, but gradually his teachings were…” he hesitated slightly, nervously, “-accepted by all. And once Earth was unified, we flourished. To avoid the problems of Stat- Pulse weapons disabling the mechanoids, enhanced human technologies were developed. Thought computers – like this one – ” he tapped the small dark postage stamp square at his right temple, “control everything, linked to the unique thought patterns of individuals.”


Thought control. ‘Pink Floyd were right to be worried’ she thought abstractly to herself as she digested his words. Eugenics Wars. The phrase chilled her.


“Mechanoids do non-essential tasks. All Order forces are human controlled. The growing populace needed to expand and we turned to the heavens. And expand we did, for centuries, until we met the Deracon.” He shuddered, involuntarily. “We don’t know their true name for themselves, these creatures. But ‘Deracon’ is their battle cry. It was all the screeched at us in the hand to hand fighting on the outer world colonies. We had to call them something, so that was it.”


He then went on to describe the war and the final battle. How the scientists had already been working on the time drive with a view to getting her D.N.A, of recovering the lost perfection of humanity. But the disasters against the insects had put new urgency on their work and ironically, in the moment of triumph, the battle had been lost. So the time drive became a means of escape rather than salvation. But now, she could help them. Both genetically, with her cellular make-up, and physically, by her building a new Chronos drive and returning to actually fight the aliens.


He made it sound so easy. Kara didn’t quite know how to break it to him that she wasn’t human after all.


She stalled for time instead, saying she needed to think how best to help them IF she could. Though really she meant if she should. Far from being disappointed, her audience gave her a round of applause that was deeply unsettling.




Over the next few days she helped them as much as she could to understand how things worked in the 21st Century, using her heat vision to melt their gold bars into smaller strips and then using her contacts in the jewellery sector to turn it into hard cash. She had foiled enough jewellery store robberies in her time that all were more than willing to help her.


Using the money she had leased a large mansion out of town for them. Although with twelve bedrooms they still had to double up whilst some slept on make shift beds. Except for their leader of course. Kara didn’t know what to make of him. Alternately he was a friendly, grand-father type character then the next a snarling, angry monster, and although never directed at her, she got the impression it was only a matter of time. But it was what he asked of her that concerned her. To travel back with them to the future, to wage war against an immeasurable enemy. With her flight and strength and heat ray vision she could travel through space, destroying the creatures whilst being small enough and fast enough to avoid their acid weapons. Even if she was hit they were sure the acid would not harm her. Probably.


She didn’t like the thought of being used as a weapon.


“How does this time drive work?” she asked.


“If you are going to travel anywhere, you would use the fastest mode of transport available, yes?”
He asked her, to which she nodded.


“Yes, but…?” she queried.


“Time travel is all around you…you only have to gaze up at night…”


“LIGHT!” she exclaimed excitedly. “You travel using light!”


The All-Father smiled. “Partly. But when you look up at the light from distant suns you see particles that left their destination millions, billions of years ago. By measuring distances from one star relative to an older one, we can work out where we need to be along that older light beam length to appear when and where it gets to Earth. But that is only a part of it. The Chronos Drive uses light within light, so within the individual particle itself there is a light beam. What we call a Time Cloak. Light folded back upon itself, whilst we are accelerated beyond imagining, encapsulated in a sort protective pod. You see the stars as a point of light but the beam radiates in all directions of course, and the pod simply sits within it. It wasn’t without its failures. You have heard of the Richat Structure?”


She nodded.


“That, it turns out, was one of the probes that failed. We lost another over Tunguska in the last century of your time.”


‘Well that explains two mysteries’ she thought. “How are you going to travel to the future?”


“We haven’t worked out how to travel forward with living tissue, yet, though we have sent information through the time gateway, like your whereabouts, but we haven’t tried it with people. But with the advanced calculations and light readings from the future, I’m sure you will be able to solve that problem with Chhengri and Tjulias and our other scientists. We must return to save the Empire, to save Earth, to save humanity.”


“This …Empire….you are its Emperor?”


“No, Angel. It is an Empire in name only. It is more of a commonwealth or a confederation of colonies. I am its… spiritual head no more.”


Something in the way he hesitated and turned away from her as he spoke made her doubt him.





So she had a lot on her mind, as she sat in Rob’s café three days later, playing idly with her fingers running around the rim of her bone china cup.


“Watcha got for me then?” he said to her with childish excitement, grinning at a her like a maniac and raising his eyebrows expectantly.


“Hmmnn? Oh, not today, Rob, I got a lot on my mind.”


“Awww c’mon… I’ve been waiting days…” he looked crestfallen. She sighed wearily.


“Ok…” she thought for a moment. “’In my experience, hotels don’t tend to advertise that their rooms come complete with corpses…its bad for business’.” she said idly, not really in the mood for this.


“Ohh…now that’s a good ‘un. I’ve heard that one too, so musta seen the film. Don’t ring any bells. You got me there. I’ll have to have a bit of a think on that.” He wagged a finger at her then noticed she wasn’t even listening but just staring into the distance.
“Boyfriend trouble , eh?” he said warily.


“Hmnn? Oh no,” she sighed,”just…stuff.”


“GREAT!” He said delighted.”I mean, er… not great you got problems…but …er…I …er…So what’s on your mind?” he said hurriedly. “Weight of the world on your shoulders, eh?”


She smiled quietly to herself . “Oh, I can’t really say. Just stuff.”


“Well, I only know one bit of advice, Brown Eyes, something my dear old Dad told me, passed on from father to son down the generations of Thomas’ since time immemorial. But I don’t think it’ll do you much good though…”


“No? Oh go on, try me.” She said dispiritedly.


“He said, ‘Son, always remember… it’s the second hole down from the back of the neck’.”


Kara just sat in stunned silence, open mouthed. “Rob… how did you possibly think that was ever gonna help me, in my situation?” she asked finally.


“I didn’t. But you asked me to tell you, so I did. And it did achieve one thing…” he paused dramatically.


“What?” she asked harshly.


“It stopped you worrying about whatever-it-is for a spell.” He winked at her.


She smiled in spite of herself. “Thanks.” She said with a softer tone.


“No problem, lovely girl. But look, seriously, ok, you don’t want to talk, I get that. But take your time, have another cuppa. Think it through.”


“Rob, ….would you help people if you didn’t agree with how they were doing things or what they were gonna do?” She asked. She still had concerns over some aspects of what the All –Father had told her, or rather hadn’t told her.


“Sure. Help anyone, me. Oh, wait! I get it! I understand now! One of your mates is cheating on her boyfriend and she’s using you as an alibi, and you don’t know whether to tell him or not, right?”


“Errr….” What the hell. He would never believe the truth. “Yep, you got it, spot on.”


He beamed happily. “I KNEW IT! That’s a toughie. Look, I know she’s your friend but sometimes people pull the wool over your eyes. Maybe she’s got good reasons for doing it or maybe she’s just a bitch. You only heard her side of the story. Maybe it’s not as clear cut as she makes out. Ask around, ask your friends, if you can, talk to the bloke. Find out as much as you can.”


He was right. She had only heard the All-Father’s side of the story. And he was one of the ruling elite.
She needed to talk to the rest of the group, to find if they were telling her the whole story. Empires were never beneficial to all. The great achievements of Rome were built on the backs of slaves.


He came over and topped her up. “Life’s always better with a cup o’ tea. And just take your time and think about things. There’s always a solution if you think long enough. It may not be what you want to do, but sometimes it’s what has to be done. You take ol’ Harve there.” He gestured at his not so faithful companion , who was spread out on his back with all four paws in the air, enjoying a dog nap. At the mention of his name he opened one upside down eye and stared suspiciously at his master.


“One of the great minds of the 20th Century…”


“That? He’s fourteen! He’d have been one in the last century” she said incredulously, gesturing at the prone Spaniel, her mind elsewhere and only half listening to him.


“No, not ‘im, ya stupid cow! Who he’s named after! R.V. Jones! You heard of him?”


She had, but to keep up her guise of Linda she thought it best to feign ignorance, shaking her head. Plus she wanted to see where he was going with this.


“British Scientist. World War 2. Saved thousands of lives, just with his ideas. Didn’t invent weapons or stuff as such, but just thought about the best way to do things. Tracked down the German rocket program single handed. Know how? He figured if you are firing rockets you are gonna want your best radar guys on the case to track ‘em. Who are the best the Germans have got? This particular Luftwaffe unit. Get the Resistance in Europe to find where they are based, keep an eye out for troops and trucks with this insignia on, and voila! That’s where your secret rocket program is. Brilliant! RAF bombed it to shit. Set it back months. Saved thousands of lives. Then later on, Jerries finish it, are sending over the doodlebugs, yeah, big rocket bomb things. Hitting London. HE comes up with the idea of a network of fake German agents transmitting data back to Berlin that they have overshot. Giving then duff trajectory information and all that. So the Germans of course then change the angle and range and all that and now the bombs are falling short. Not all, but many. Genius!”


“Clever guy.” She commented.


“Yeah, but don’t you see? He was MAKING those rockets land in areas where they wouldn’t have hit before. Falling on farms and villages and small towns and guys just out in their fields and stuff. He knew he was killing people by his actions. People who would have been alive except for him. But the point is, he was killing LESS. And saving London in the process. Now that is a tough decision. Next to that, your mate cheating on her boyfriend ain’t much, is it?”



He was right. She found herself totally surprised, but he was right. Sometimes you had to do the lesser of two evils. She had been wrestling with herself as to whether she should change mankind’s future destiny. Now she had reached a decision. She was originally going to change it by remaining here and making a better future for the people of Earth. But did she have that right? Many more billions of lives were threatened in the future, and the very end of humanity itself if the patriarch were to be believed. So, now, she decided, she would go with them after all. But the beauty of time travel was of course that she could return back to this time AND still make a better future. She suddenly felt much more content.


‘ZZZZZZZzzzzzzzzzzzzuuuuuuuuubbbbbbbbbb!’ there was a dull thud as a large bee flew into the shop window, then settled on the glass. R.V. Jones suddenly sprang into life, leaping up arthritically onto all unsteady fours and barking, hoarsely. It was the quickest he’d moved in years, and surprised everyone. Even Spartacus retracted all four legs into his shell at the movement.
The dog looked terrified. His eyes were wide and his ears were down, his tail tucked between his legs as he stood there shaking, barking at the window.


Kara heard it too then, a low, throbbing hum, still some way off.


“What the ‘ell is wrong with you, ya silly sod? It’s just a bloody bee…” Rob was chastising the Spaniel when he was interrupted.


‘ZZZuuubbbb.’ Another bee hit the window.


‘ZZZubbbb. ZZZZZubbbbb. ZZZUB-zzub-zzzubbbb-zzzzzzubbb’ followed by another and another.


By the time the 5th one hit all eyes were on the window. But it was what lay beyond the window that R.V. Jones was barking at.


“HO-LY SHIT!!!” Rob exclaimed. “Everyone, get into the store room, now!!! NOW!!!! MOVE!!!!”


Moving down the street was an enormous horde of flying insects, so dense they were blotting out visibility of the street behind them. They were still several hundred yards away but their leading members were already slamming into the window in increasing numbers. The droning noise of their wings growing with each second.

“CHRIST! LOOK AT THEM BEES! Everyone, quick, in the storeroom, c’mon!”Rob waved his customers into the back room.


“Get everyone inside, I’ll go get help!” Kara yelled as she ran passed Rob and out the back way.


“BROWN EYES!!! COME BACK!” He called after her desperately, but she had gone. “Oh shit, no!” he said tearfully as he ushered the last of his three or four customers through the door into the storeroom. The shop went dark as the daylight was blotted out as the windows filled up with insects. He turned and was about to enter himself, when he heard the desperate whimper and spotted Harvey plodding in painfully slow clockwork procession, a few inches at a time towards him, whining with the pain from his joints. His rheumy eyes looked up pleadingly at his master as they both knew he wasn’t going to make it. If he had had four days to make the journey, it would’ve still been touch and go.


“AWWWW! You stupid bloody ‘ound!!!” Rob said as he stepped back into the café, and he had already closed the store room door and gone back for him when the main force of the swarm hit the windows and the shop’s glass doorway, shattering them both in a shower of glass. He knew now they both weren’t going to make it, but somehow, that didn’t matter anymore. Rob was crouched, about to scoop up Harvey when the window went and he covered his dog from the glass as he waited for the swarm to engulf them.


“It’s alright, boy, I’m ‘ere…” he said in a quietly resigned voice as he cradled the quivering, terrified animal. Rob had his back to the window and his eyes clenched shut, but R.V. Jones saw the whole thing, and started to slowly wag his tail.


A red and blue blur shot through from the back of the shop, faster than lightning and truer than an arrow. The drone of the insects wings was a constant buzz now, a near deafening ‘ZZZZZZZZZZZZZZZZZ’ noise after the glass shattered and the swarm advanced into the cafe. As Supergirl flew she used her breath to blow the creatures back out of the shop, tumbling the tiny bodies into each other. She stood between Rob and the doorway, blowing repeatedly to drive the black horde back. So great was the swarm that its own mass stopped the spinning insects from travelling very far and they gradually pressed in on all fronts, so each time she took a breath they crowded in a few more feet towards her. This wasn’t working. She suddenly drew in an extra large lungful and the creatures crowded in during the lull, within the shop doorway once more, just a few feet from her now.. This time when she expelled her air it was as a freezing blast that numbed the first few feet in depth of the swarm, the creatures dropping from the air like stones. But the multitude behind them pressed on, the fallen bodies forming a tide line every six inches or so on the shop carpet as their tiny bodies dropped, numbed to the floor. Supergirl was having to turn her had to encompass the whole shop front and each time she did so they were able to encroach a few inches each time. This wasn’t working either. She realised that sound would carry further into the host than her breath ever would. She was finally forced to use her speed and her vocal powers, first emitting a sub-sonic blast as she whizzed back and forth from wall to wall that stunned the first several feet of the insect mass, then freezing the stricken insects and the leading edge of the wave that was not immediately debilitated, before blowing the whole mass back into itself, finally getting them clear of the shop interior. Once the host was predominantly outside, she was able to use her heat vision to incinerate thousands of the creatures. She estimated the swarm to have between 60,000- 80,000 individuals of which she had destroyed about a quarter. But she knew she was struggling to deal with them this way. The throbbing pulse of the creatures wings was a constant irritating whir as she decided on a new plan of attack, as the creatures pressed in on her from all sides. With her speed she flew into the heart of the swarm, blowing, freezing and burning the insects immediately in her path before she spun on the spot, creating a super-speed vortex of air like a mini tornado that was simply too powerful for the tiny creatures to escape. Many struggled to exhaustion before they were sucked into the spiralling updraft. She kept it up for several moments, perhaps 30-40 seconds, before she finally dropped back to stand before the cafe doorway. She literally got her breath back for a moment then turned her heat gaze on the black mass, turning them to microscopic cinders. By the time the vortex slowed and lost its momentum she had destroyed the entire swarm, save for the several thousand stunned by her sonic blast that were still lying around the entrance way.


She stepped back into the interior before using her breath more gently to blow the bodies still inside outside, where she then proceeded to incinerate them. Only at this point did it sink in, as she looked at the tiny bodies on the pavement. The swarm was made up of all kinds of species – bees, flies, lady bugs, hornets, moths, even butterflies – all types of insect were gathered and dying at her feet.


Rob staggered shakily to stand beside her, holding his beloved dog, R.V. Jones providing a grateful and very soggy lick to her cheek.


“Bloody ‘ell.” Was all Rob could say at first, as he seemed to be understandably in shock. “SUPERLADY!” he said finally, in awe.


“Er… its Supergirl, actually.” She said with a modest smile of genuine amusement.


Rob didn’t seem to take it in, grabbing her arm awkwardly as he struggled to hold on to the dog in his arms “SUPERLADY! My mate! SHE WENT OUT THE BACK WAY FOR HELP! OH, GOD! You have to find her quick, QUICK! You gotta make sure she’s ok!”


“If you mean Linda, she’s fine” Supergirl answered, “I took care of her”


“Who’s Linda?” Rob said blankly. “I mean pretty girl ‘bout your height, mousey –brown hair, she ran out the back to go and get help”


“Er…yeah…that’s Linda. I ran into her on the way in, she’s fine I set her across the street in another building.”


“It is? Linda. I had 'Jane' in my head for some reason. And she’s ok? Oh, thank god she’s ok. I’m bloody ‘opeless with names. That’s why I call her Brown Eyes, keep forgetting her proper name. Did she tell you what ‘appened? Just like bloody loads of them just come from nowhere. “ He said, shaking his head in disbelief.


“Yeah, she told me everything” Supergirl said.


“Really? That was bloody quick ‘cos you appeared like a second after she left…”


‘Oh, heck.’ She thought. “Er …yeah, it’s like an e.s.p thing” she said awkwardly.


“You read minds?” he asked in awe.


“Er…kinda…it’s like a sixth sense…a crimefighters intuition kinda thing” she said uncertainly.


“Oh. SHIT! Look, if you can read minds, I’m really sorry about what I was thinking when I first saw you in that skirt” he said embarrassed.


“It’s fine…” she said absolutely positive that she did NOT want to know what he had been thinking.


Rob looked around the wreckage of his shop. “Spartacus!” he cried in delight as he saw his tortoise, who seemed to be merrily chomping on one of the luckless creatures that had somehow had the misfortune to make it into his tank. “He got one of the buggers!” Rob said happily, as if that had tipped the balance.


“You make sure everyone is ok.” Supergirl indicated the customers tentatively coming out of the storeroom.


“Ok, Superwoman. You ain’t off already are you?” he asked. He truly was useless with names she realised.


“No….” she said as she squinted in the sunshine looking back down the street with an agitated frown. “I’m gonna be dealing with that…” she pointed back down the street where the sidewalks and asphalt were black with a mass of creatures crawling towards them.


”Oh, bloody ‘ell. I suppose the hygiene people will close me down now.” He said absently, staring at the new insect host in a daze.


“They aren’t in your shop, Rob. Although it does seem to be where they are headed.” She frowned.


“P’r’aps they can smell the cakes?” he said. It was a stupid statement, but one she put down to mild shock.


“No. No, I don’t think so.” She responded, frowning, never taking her eyes from the approaching horde.
“I think they are coming for me." she said grimly.
Attachments
Giant-blue-eye-mauritania.jpg
This is the Richat Structure in Mauritania. No one knows for sure what created it
Giant-blue-eye-mauritania.jpg (37.64 KiB) Viewed 22169 times
Last edited by tallyho 13 years ago, edited 1 time in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

The plague this nowadays too, am looking forward to read more
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Rosy future you painted there T lol.

Hope SG can change history, very curious who sent the bugs after her.

Keep up the great work!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Thanks a lot for the comments guys, and thanks too, to all who have stopped by.

To those who think its a load of hogwash you might be interested in the sciencey stuff that was my inspiration.

This has always been on the cards since 1966

http://www.computerworld.com/s/article/ ... _a_reality

This is just mind blowing -

http://www.technologyreview.com/view/42 ... -cloaking/


If you don't check out NASAs astronomy picture of the day, I recommend it -

http://apod.nasa.gov/apod/ap130519.html

And finally if you want to get ahead of the game in the story this will be making an appearance soon
The amazing Voynich Manuscript ( and no, I'd never heard of it either!)

http://en.wikipedia.org/wiki/Voynich_manuscript

And if you are not interested then don't read them, but honestly where's your sense of wonder at the world?
:w00t:
Next story update will be a week or two.
Cheers all
T.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
Centurion
Staff Sargeant
Staff Sargeant
Posts: 174
Joined: 16 years ago

Re: Supergirl and the Last Human

I can't imagine how the Voynich manuscript is going to figure in this, but I can't wait to find out! :)
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Part 6

“Keep everyone back, inside!” Kara commanded Rob, as she scanned the immediate vicinity in case there was another swarm of some kind. There was only the black mass scuttling towards, her still around 60 feet away but closing fast.

“I got some spray for bugs in the cupboard?” Rob said questioningly.

“Please! Just get inside. Now.”

“It’s my shop, I can’t just let you protect it on your own. I can run about and stamp on them or something…” He was clearly in mild shock and Kara decided more forceful persuasion was needed.
Of the psychological kind.


“Rob…there are probably lots of spiders. Big ones…” she knew he was arachnaphobic.


“Oh god, are there? I hate them bastards.” He swallowed hard. “But I said I’d stay and help you…and I will.” He said with determination. She was actually surprised and slightly pleased that he would face his worst fears to stand beside her. But she needed him inside not in the midst of things.


“The best way for you to help is to get back inside, out of the way. Please? Seriously.” She said.


“Okay!” he couldn’t get away quick enough at the thought of there being spiders and she smiled despite the seriousness of the situation before she turned back to the mass. Earth threatened by a giant insect race in the future and now thousands of insects descending on her? She didn’t believe in coincidences.


There were actually no arachnids in this host. There were beetles, cockroaches, and thousands upon thousands of ants and termites but no spiders. This was odd, but she was more struck by the pointlessness of this attack as a threat. She could simply hover and none of these creatures could touch her. Whoever had sent them clearly didn’t know much about her powers.
But perhaps she wasn’t the target? She decided on a simple test. She leapt around a foot into the air, then flew at what for her was a slow speed over the predominantly black coloured mass.
Sure enough they slowed and stopped, and then turned towards her. So they had come for her after all. Well these simple insects were clearly outmatched.


As they seemed to be interested in her she lead them away from the café and the approaching sirens as the first emergency teams arrived; several police cruisers; an ambulance; a fire truck and two City pest control vehicles. She shouted at them to stay back , that she had everything under control, then proceeded to lead the host into the nearby campus grounds. More creatures seemed to join the teeming mass as they scuttled after her. She was wary about moving too fast lest the insects gave up following her, so she stayed just ahead of them, hovering a few feet above and ahead of the horde. Once she was clear of any buildings she flew a little way ahead, set herself down on the grass and waited for them to catch up with her. They seemed to stop a few feet from her, milling around almost in confusion, before a large mass of ants started to approach. This had gone on long enough, she decided. Reluctantly, she used her heat vision to incinerate the luckless creatures. It was embarrassingly easy. They could not harm her and with her flying ability she simply hovered above them, untouchable. They scrambled around in a frenzy and after a few minutes, by which time most of the multitude had been destroyed, they started to scatter. The pest control crews started to spray the remnants with chemical smoke that finished off what was left. It had just been such a pointless, meaningless attack on her that could never have hoped to succeed. If the flying insects had come at her at the same time as the ‘creepy crawlies’, as she had mentally dubbed them, then she may have had a little difficulty, but separately they were always going to fail. Not big on the smarts then, whatever had chosen to accost her this way. She took no pleasure in her actions, not even a grim sense of satisfaction. It was just all so senseless. She decided she needed to confer with the All-Father, or rather his followers. She didn’t know much about this Deracon race that was threatening Earth but this insect assault seemed to have their name all over it. But they were in the future. She needed to know more, about them, about the society she was expected to save and about how exactly they expected her to help them.


Just a little while later she sat, cringing on the sofa of the rented mansion, the 50 inch tv playing a live newscast of the days’ events from outside of Rob’s café. And that was the source of her chronic embarrassment. Rob, in his bid for stardom, was coming over as the village idiot.


Welcome back to Channel 9 News. Now what would you folks say if I were to tell you that an invasion of insects was thwarted here today in Metro City, by a courageous tortoise and an elderly Spaniel? Sounds like a shaggy dog story? Well, Supergirl may have helped out, just a little bit. We go over live now to Tom Walker, at the scene.”


Rob stood clutching Harvey in his arms, as the newscaster began the broadcast, smiling inanely behind him like a happy mental patient. As the reporter described the day’s events, Rob stood in front of the shattered windows of his shop , pointing towards a scrawled hand written sign that said ‘Even More Open than Usual’. Supergirl winced in empathy.


Thank you Sally. I’m joined here by Mr Rob Thomas, owner of the T42 Tea Shop just off campus here at Metro Uni. Where, for some unknown reason, a mass of insects descended on his store, not once but TWICE, in just a few minutes. Mr Thomas, could tell us in your own words exactly what happened?”


Well, Kent, Superlady was awesome! But it was ‘arvey first cottoned on to it all” Rob hoisted the dilapidated Spaniel in his arms. The dog seemed nonplussed by the whole affair. “ He first ‘eard the sound of the little buggers flying down the street-“


“Er, Mr Thomas I think you mean Supergirl, and if you could watch your language, we are a live broadcast…”


“Oh, sorry Kent.



Er…its Tom Walker, Mr Thomas.”


“I thought you was Kent Brockman?”


“Er no, he is a Simpson character, Mr Thomas. Could you please just tell us what happened, in your own words?”



Well, like I say ol’ Harvey here heard them coming and leapt into action, barking like mad and I thought first off he’d just gone bonkers, just barking at a bee that hit the window, but when we looked up, there was this big huge cloud of the little sods flying straight for the shop. Er, insects that is.”


And what was going through your mind when you saw them?” the camera cut to a shot of Spartacus, his tank now adorned with a badly scrawled ‘I’M SPARTACUS’ sign.


Well, Kent, I’ll tell you straight, I was shitting bricks…


The whole interview went downhill from there, culminating in the excitement getting too much for R.V. Jones as the elderly dog, cradled lovingly in Rob’s arms, proceeded to urinate on his master live on national television, prompting a string of expletives that ended the live transmission.


Supergirl sat in awkward embarrassment, surrounded by the confusion the broadcast had generated among the time travelling group.


“The Deracon are huge insects, not the mere mundane swarms you saw today…” the All-Father said in bewilderment. “But this cannot be a coincidence…yet I don’t understand the significance.” He shook his head.


Chhengri spoke up. “It would suggest…they too have a presence in this time…” he said hesitantly.


“How is that possible?” the Leader demanded.


“I-I …do not know, Sire. We broadcast the finalised time drive details to the fleet at your order…perhaps they intercepted it, built one of their own…”


“So quickly? In mere days? IMPOSSIBLE!” He shouted angrily at the young scientist.


“I-it is a TIME drive, Sire. They have infinity at their disposal to perfect it…”


The All-Father spun around and landed a vicious backhanded swipe to the man’s jaw, sending him staggering back as Supergirl leapt up from her seat in alarm.


“Get out of my sight! GO!!!” the patriarch barked as the young man, still shocked stumbled away.


His actions made up Kara’s mind for her. “I need to know more about what has happened between these creatures and your society. I need to understand both if I am to help you. Can the media orbs show me your laws?” You could learn a lot about a society by how they codified their laws.


“There is no record of such things on the orbs.” He said hurriedly. “Our laws are fair and just” The mostly oriental- based style of his speech before the translation, give his words a strange clipped and soulless tone when migrated into English by the translation device.


“Ok.” She didn’t press for the truth of the lie she had detected in his voice and body language. “What kind of punishments do you enforce for example? Just so I know what’s at stake if I fail.” She smiled disarmingly at him.


He smiled gently back. “No danger of that, sweet Angel. Our punishments are nearly always centred around re-education. Offenders are shown a better way to behave, put simply. But I do not wish to dwell on such things. You asked of the Deracon, the Orb can show you all that we have on that vile race.”


She watched the playback over the next few hours, much of which she had already seen over the previous few days. The first encounters were very sketchy, largely because the Earth forces had been annihilated so easily. It seemed fairly clear that these creatures had sent their smaller cousins to attack her at the shop, presumably controlling them somehow to their own ends.


But how? But more pressing from her point of view was what exactly the All-Father was keeping from her. She had tried to talk informally with the ‘refugees’ as she thought of them, but every time someone would hover close by. The answers were inevitably polite, clipped and formal, uttered with suitable reverence as they considered her divine. She had no proof, but she sensed the nearby lurkers were warning the interviewees off in some way, probably telepathically. One answer was always the same. ‘Any offence is met with re-education, to show them a better way’. She decided to take a different approach. She asked for them all to be summoned together and for formal introductions to be made, so she could learn what each person did in the society as well as get all their names, though in truth she had already met and spoken with most over the last three days. Her real motive was to try and get them to reveal more indirectly in terms of how they behaved and what they actually did. She had been spending time with them in small groups as she tried to show them how the cell phones and tablet pcs she had bought them all worked. She had thought the smart phones would help them integrate with life on earth in this time, as well as to serve as a back up if any did get separated from the group. But in truth the phones had been a disaster. The scientists had taken theirs apart, laughing at the arcane technology, whilst what were dubbed the ‘Worker Caste’ members, who were in reality advanced mechanical and electrical engineers, had cannibalized theirs to supplement their own technological machines, like the data orb, which were limited in number. The other groups had viewed them as charming toys, staring at them inanely before becoming bored or disinterested. She had been slow to realise that they were trying to use thought to operate them, the notion of actually pressing the screens to control the devices literally alien to them. This attitude explained why they were constantly forgetting to turn on the lights at night when it grew dark. They were thinking them on, so of course nothing was happening. They had become frustrated and abandoned the devices fairly quickly, though they retained a form of reverential position as a sacred relic amongst some, as they were a personal gift from the ‘Angel’ as they insisted on calling her.


She had gradually learned that that whole reference was derived from the Sacred Journal, the old writings of the Second Father that had survived the Falling of the West. It would appear that on the 21st of next month she would save a small boy from an accident, some said a fire, some said a flood, some said an auto accident. He would go on to become the First Father, inspired by her actions to pass on his beliefs to his son. The son, the Second Father, would grow up to become the Leader of the Terran Order, unifying the people of Earth under one banner, ending the wars that would rage after the outbreak of Lehrmann’s disease. The whole thing troubled her. She had asked to see the Journal, but the All-Father had politely requested that she did not, lest her foreknowledge of events yet to come influenced her actions adversely. His answer was reasonable but unsettling.


But she was even more unsettled as she spoke to the group. She noticed three women who had hung back, not forming part of the introductions. They stood together heads bowed, avoiding eye contact.


“Who are they?” she had asked of Chhengri, but before he could answer one of the Lurkers as she dubbed them stepped in.


“They are of no consequence Angel. Mere factotums as it were, please do not concern yourself with them…” the Reacher had interjected. Jaeger, at his elbow looked sternly in their direction. After an instant they scattered to other rooms in the large mansion.


“Well at least tell me their names?” Supergirl had asked, knowing instantly that they were the ones she needed to seek out, as they were the ones that were being kept from her.


“Errr….Tracy….Elle and I believe Emaritzina?” the Reacher said somewhat hesitantly.


“Emaritzinakarulanaverronishnalara. She is from the Valtos colony, they absorb the female line names of the mothers and grandmothers to their own, for some reason. It is an oddity on that one world of the Empire. Known as Em, I understand” Jaeger announced. “They …do menial tasks, nothing more.”


“I want to speak with them. Now.” Her tone said enough and reluctantly they were summoned.
But unknown to Jaeger and the All-Father, with her super hearing she heard all of the women receive the same hissed instruction as they were rounded up and told to go and see her – “DO NOT MENTION TALOMERE”. That at least gave her a name - a person, a place, a city? She would not bring it up directly, not yet, she decided.


The three assembled before her, head bowed waiting on almost reverential silence as they were addressed first by Jaeger.
“Elle…Em…Tracy… the Angel wishes to speak with you. Do not abuse this honour.” Jaeger said with a tone laden with menace.


She tried to reassure them at first as they were clearly terrified, telling them that nothing was wrong.But all she got out of them were standard scripted answers –‘We serve the All-Father’. When asked specifically what they did they simply said ‘anything he wishes’.These three women, of all the group, seemed the most subdued, often just standing lined up at the rooms edge, hands together , head bowed.’Like slaves in Rome’ she thought. But when she had asked the question directly, if they were enslaved, all had denied it, even laughing for the first time with genuine humour. Before again the ‘We serve the All-Father’ answer.


She was getting nowhere like this, and then the ‘lurker’ Jaeger interrupted her.


“If the Deracon are somehow here…they were able to trace you to that café. They may be able to trace you to us. They cannot yet be here in numbers or else panic would have already broken out. The Government of this Island of the Americas would surely have detected them. There must be but a handful. Even so, we are not yet ready to face them. You cannot keep coming here. We need you to deal with this danger. Perhaps it would be better if we tried to flush them out…” Jaeger said.


She knew what he meant. “You mean, I go back to the café…use me as bait?”


“We will send warriors and our telepaths with you. The Reacher can try and trace the beings controlling them if the creatures come again. Then Elgin and the Warriors can …deal with them.”


I’LL deal with them.” She said forcefully. She hated to admit it, but he was probably right. The telepaths may well come in handy. Though she didn’t like using a public place for a showdown they had little else to go on. She arranged to meet discreetly at Rob’s café the next morning, whilst she spent the rest of the evening searching the industrial quarter for any large swarms or build up of insects. The derelict buildings and factories proved empty of any large ‘nest’ or gathering, beyond the usual insect numbers. Although given the days events, these were actually less than would have been expected.


The next day she found herself milling around the campus fields, reluctant to endanger her friend and the café clientele unless she had too, desperately hoping that the creatures would come to her here , in the open. But by lunchtime nothing had happened. She had lain on the grass, ostensibly a student reading in the sunshine, but she had not taken in a word of the book. Almost absently she flipped the pages and within 10 seconds she had finished it. She blew out her cheeks in a slow sigh. There had to be a better way than this. She decided to venture to the café after all, in case that was the connection the insects had to her somehow. There were three telepaths with her; the Reacher and two warriors, one male , one female; Jaeger and the warrior Galen, and a third that she had barely dealt with, an oriental woman named Jianko who was with the warrior Elgin. Kara had insisted that all were unarmed, fearing a bloodbath if they were carrying weapons. The warriors were only there to protect the telepaths and if a human was somehow involved in controlling the creatures, to follow them or restrain them. She had insisted on Em joining them, ostensibly so that she could pass discreet messages to the rest of the group but really she hoped to have a chance to talk with her, to question her. Em had been like an excited school girl at the prospect. But whilst she had come along, they had so far kept her well away from Kara.


The refugees weren’t very adept at blending in. The notion of sitting on the grass was totally alien to them, so they just stood around in awkward, clumsy groups. Em still stood head bowed, despite Kara’s best efforts. She felt embarrassed to be associated with them. Two warriors had turned up dressed in tuxedoes, having seen 'For Your Eyes Only' for the first time, before she had forced them to change into more ordinary attire. Thanks to the shimmer suits, that had taken seconds (and a discreet retreat behind a van so they were not seen). She dreaded to think how they would handle the café, but she needed to see if that brought on another attack. They had pre arranged that they drift in in ones and twos a few moments after herself.


As she walked in, the glaziers were working on replacing the boards that had been put up temporarily overnight. One window was done and they were almost done with the second. When Rob saw her his face lit up with genuine relief that she was safe.


“OHHHH, THANK GOD! Christ on a bike, Brown Eyes, where’d you go, love? I been worried sick.” He put down the book on genealogy he’d been browsing and hurried around to confront her, grabbing her in a ferocious hug that, were she not Kryptonian, would’ve hurt.


“Errr….little help?” she said with a grimace, more for appearances sake.


“Oh, Christ, sorry.” He released her and his smiling face deflated before her eyes.


“Did you see me on the telly?” he asked sadly.


She grimaced and nodded silently, wincing in empathy.


“Harvey pissed all over me…” he said dispiritedly in a small voice.


She nodded again. “Yep….”


“Been looking up the Thomas family motto…” he gestured at the book on the counter. “Turns out its ‘Caveat Canem’” he smiled gently at his weak joke. Harvey opened an eye at the sound of her voice, gave a half hearted flop rather than a wag of his tail, and stayed sprawled near the storeroom, emitting a sort of huffing sigh of recognition.


“Awww, ‘Beware of the Dog’? Don’t be mean to him, it wasn’t his fault, was it, Harvey? Just one of them things, Rob.” She said , getting a full blown wag this time from Harvey at the mention of his name. She grimaced at Rob.


“Maybe a lot of people didn’t see it?” he said with a small amount of optimism. She shrugged, noncommittally. “Though my cousin Colin said its already gone virus on the old interweb, is that good?”


Viral, Rob. Gone viral. And nope, it ain’t too good…” she said softly, squeezing his arm in reassurance.


“Oh. I thought it might mean it was infected so people wouldn’t watch it. Guess not , eh? I don’t know much about that computer malarkey.” He seemed totally deflated.


She realised that there was no radio on in the shop and he wasn’t ‘singing’ his own bad rendition of something when she walked in. He really was down in the dumps.


There was a loud thump as an empty beer can hit the new window and harmlessly bounced off.
“SOD OFF, YOU LITTLE BASTARDS!!!” Rob leant around her to shout out at the unknown assailants. Outside someone was laughing.
“Sorry folks.” Rob said apologetically to the two or three customers in the shop.”All part of the glamour and excitement of a modern tea shop owner…” he smiled a brittle smile to the room then turned back to her.
“Been happening all morning.” He said sadly. She looked at him closely then and realised he was on the edge of breaking down in tears.


“Rob?.....” she said with concern.


“It’s them bloody yobs from the other day…you seen what they wrote on the wall?” he gestured towards the outside wall. She stepped outside and around the corner to read ‘PISS PANTS’ in big red spray paint letters on the side wall. Gesturing at the time travellers not to follow her. She threw a glance at Rick and three other guys who were nearby.
When she came back inside, Rob was on the verge of tears.


“Rob? This ain’t like you…” she said with genuine concern.


“Oh, I didn’t give a damn about that”, he said dismissively,” but they keep throwin’ bottles and stuff at Harvey whenever he goes out. I tried chasing them but they just laugh and run off then come back 10 mins later. Had it all bloody morning. It aint just them. I thought a bit of free advertising would be good for the shop but people are just coming to bloody gawp and laugh at me, and now they're calling me pisspants. Its putting off other customers. I just wanted to get people to come ‘ere. That’s all. Now I’m a bloody laughing stock.”


“Go home, Rob, get some sleep. You look lousy…”


“Yeah, well you’d look knackered too if you’d been up all night searching for your mate…” he smiled weakly.


“Oh, no!” she said “You were out looking for me?” she asked incredulously.


“Hey, somebody has gotta keep you out of trouble…” he looked at her tearfully with a feeble grin. “ I was worried when you never came back…” he sighed. “I went round the hospitals in case you had the thing the guy in ‘Momento' had, you know, that thing like amnesia.”


She understood now how he was so brittle. Worry, lack of sleep, the after effects of the mild shock, coupled with a sense of shame at his global embarrassment, all rounded off by several hours of taunts and jibes and even assaults on his best friend, Harvey. ‘No wonder he was cracking up’. She thought.
She felt a terrible sense of guilt and was genuinely touched by his affection for her.


“Rob…” she didn’t know what to say. “I’m so sorry. I didn’t think…”


“It’s alright, now I know you are safe. And it was James Mason.” He smiled.


“What?” she asked , thoroughly confused.


“That was it, wasn’t it ? James Mason in ‘Jules Verne’s Journey to the Centre of the Earth’. Your quote, yesterday. The body in the room bit.”


“Spot on.” She smiled, he was coming back to his normal self.


He smiled happily. “Did you see the sign?” He pointed proudly at Spartacus’ tank and the ‘I’M SPARTACUS’ sign adorning it. “I thought of that” he said rather obviously.


“That’s great Rob,” she smiled weakly, then frowned as another bottle hit the front of the shop. “You called the cops or campus security?” she asked.


“Cops said they’d swing by when they get chance, like that’ll happen , and I’m just off campus so the college plod aren’t interested. They’re just kids. Every time I chase after them they just scatter.”


Another bottle clattered into the litterbin outside with a clang. This prompted a verbal response from Rob.
“CLEAR OFF, COCKCHOPS!” he cried out of the door at them. “Sorry.” He apologised again to the room. “That’s like how we say ‘dickhead’ back home.” He explained as her eyes widened in surprise at the unfamiliar phrase.


She had decided it was best not to know what he meant by that, then he had told her. Oh, well. That was Rob. A heart of gold but no sense of propriety. At least he was sounding more like his old self. “So you got one for me?” She asked, trying to reassure him with familiarity. “A quote, I mean?”


“Ohhh, well, I aint thought much about it ‘cos I was worried about you. Let’s see…” he rubbed his chin as he stared at the ceiling. Then he seemed to find inspiration as he stared at his Welsh flag adorning the wall opposite. “’The names Anderson…’” he said.


Matrix! EEEEEEEEE-ZEEEEEEEEEEEEEEEEEE.” she crowed.


“NOPE!!!! But I hadn’t finished. I was sayin’ it like they says it in the picture, like. So, ‘Names Anderson, though Bloody Bill is what they calls me…’ ”he said in a poor Southern drawl, delighting in her blank look and so he went on “’Red legs? They’re with the Union. Kansas is where you’ll find ‘em…me and some of the boys are goin’ on up there… to set things right…’


She paused in reflection, more for effect, then in a perfect Clint Eastwood impression said “’Reckon I’ll be comin’ with ya’ “ as she finished the rest of the quoted scene with a smile. “Cue opening credits, Outlaw Josey Wales’”.


“Aww!! Dammit!!” he shook his head. “Bloody good impression though, fair play. Your Brando the other day was terrible.”


She blushed slightly at his praise. “Thanks, charming, I must say. Well, you did quote half the film, Rob!” she laughed. “Should’ve stopped after ‘Red Legs?’. Rustle me up the usual will ya? I’m gonna use the bathroom.” She smiled, he was already more like the Rob she knew.


“Sure thing” he said as he started preparing her order, now much more his old self. He started to whistle tunelessly ‘The Girl from Epanema’, before he broke into his equally tuneless version of the words. ‘Hair-of-gold, so long-and-lovely, the girl-called Super-lady goes walk-ing by- ’” he set up the cup and saucer in time with the song.


Kara smiled as she headed through to the back of the shop and out through the rear entrance.


A few seconds later, Supergirl landed lightly on her toes just behind where Rick and his three accomplices stood drinking beer from Pepsi cans, and 7-Up bottles, as drinking overtly in public was an expellable offence on college grounds, not that it was ever enforced. Though technically here was off campus, by around forty feet. Periodically they were throwing selected empties at the windows.
The time refugees started to move towards her uncertainly, but she shook her head to keep them away.


“Hey guys” she said, smiling broadly. She recognised Rick and the other one from their last meeting, when he had seemed to be sensible. The other two, one tall, one short and scruffy she hadn’t seen before. All of them were open mouthed, Rick looking at her lecherously.


“What ya doin’ fellas?” she asked sweetly.


“Oh just …er…fooling around, a little…harmless fun. Speaking of fooling around …what you up to later Supergirl?” Rick said drunkenly, taking a swig from his plastic bottle.


“Fooling around? So that wouldn’t be flecks of red spray paint I can see on your hands?” she nodded towards them as she stood hands on her shapely hips.


Rick looked at his seemingly spotless hands “No paint on me honey” he smiled smugly.


“Not that YOU can see, anyway.” She said sternly. She looked at Rick’s friend from the other day, the one who had tried to pull him away from Rob.


YOU I expected more of.” She said sternly, as he blushed, looking suitably abashed, before turning to the tall one that she hadn’t seen before. “You, I don’t ever want to see in trouble again. And YOU,” she turned to his shorter companion “you are actually drinking cola so why are you pretending to be drunk?” she scolded, having scanned the cans contents with her x-ray vision.


The other three glared angrily at the shorter youth who shifted his weight nervously.


“You guys like the movies? Those action flicks? Arnie, Sly, Clint, Segal?” she asked as a few of them slowly nodded.


“Sure, I guess” the scruffy one mumbled.


“I like ‘em.” She smiled. She leaned close to the sensible one, speaking huskily. “Ya know what I like best in those films? The part where the tough guys tackle the no good punks on the street corner, you know, the ones who are just ‘fooling around having a little harmless fun’. The thing is, I always thought guys watching those films identified with the hero, ya know? I always thought you fellas would watch ‘em and see those boys kickin’ass with their snappy one liners and getting the beautiful girl and be sitting there with your popcorn and think ‘hey, must be so cool to be like that’. No?” Again a few of them nodded and shrugged in agreement. “Sooooo, my question is…..when did you guys stop wanting to be Clint? “ She frowned questioningly, as she looked at them sternly, staring at each face in turn. Slowly realisation seemed to hit some of them, prompting a few ‘Oh yeah’ sort of expressions. Gradually each broke eye contact and shuffled nervously, looking away.


“Hey, we was just foolin’ around…” said Rick.


“You know what, Rick? I like to fool around a little too…” in an instant she had grabbed him by the scruff of the neck and sped upwards at astonishing speed.


“WOW!” said one of the youths as they stared up after them. Just a few seconds later she shot back down out of the blue, landing beside the trio with a quivering mass of jelly beside her. Rick was white, with a light dusting of frost on his sandy hair. He was shaking and his teeth were chattering, his eyes wide in shock. A spreading tell -tale stain formed slowly over his groin.


“Oh no! Guess that makes you ‘pisspants’ now, huh? Clean it off. Now.” She pushed him towards the graffiti covered wall. “All of you. And if anything happens like a break in , or arson or even just a window put through, I’ll know who to come see, right?” the boys nodded, except Rick who was still shaking.
“Oh and guys? Try to be Clint, huh?” she called after them.


The scruffy one turned to the tall guy. He seemed to have had an epiphany. “ She’s right. I wanna be like Clint. Supergirl!” he called after her ” I’M GONNA BE CLINT!”


“Well good for you, son!” she called over her shoulder, smiling as she shot off into the air again, intending to return to the back of the café. But she stopped suddenly, hovering as she stared out over the city. It was a warm day and there was a hot shimmer in the air as the heat rose. But that wasn’t all. There was a blurring of the few clouds away to the West, barely noticeable, but she had seen it. She frowned and switched her Kryptonian vision to a different part of the spectrum.
And she had the shock of her life. For there, hovering silently over that part of the city, was a craft of some kind. She switched back to her normal vision and it was gone, just the very slight distortion, if you looked hard for it. But in ultraviolet light or her x-ray vision it was clearly visible. It had some sort of invisibility cloak, which was some feat given its size. She emitted a brief ultrasound note in its direction, her superior hearing picking up the change in resonance as it hit the invisible craft, like a submarine pinging for a target with its sonar. She timed the return echo to give her the rough distance away, approximately 4 miles. But it was muted, barely detectable. A radar cloak too, then.
Even at this distance she was able to measure it fairly accurately with her superior mind and sight. It was 9 miles long, give or take. She was speechless. The Deracon, it seemed, had arrived.


She sighed heavily. “And there goes the neighbourhood..." she said softly to herself
Last edited by tallyho 13 years ago, edited 2 times in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

Apparently we have a lot of action in the next chapter
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Enjoyed seeing SG giving those punks some lessons.

Looking forward to seeing whats up with the cloaked ship!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Thank you for the comments, hope you enjoy the next offering
Part 7

The craft was vast, much bigger than the vid replays on the media orb that she had seen. Those creature ships were the size of a small house, holding maybe 5, maybe a dozen of the Deracon, no more. This ship…this held thousands. Yet they had not come for her themselves, but sent ordinary insects to do their bidding. And now, having failed, they just sat there, doing nothing. Or waiting. But if so, for what? She was sure that just as she had noticed them, so too they had noticed her, but she could detect no sign of movement of any kind. The craft itself was shaped like a large arrow head, a rounded point at the front but flat on the underside with a rounded curving upper surface. It was deepest jet black, the top side of the hull seemed to be like a shiny black carapace, like the chitin shell of a stag beetle. There was a row of some twenty portholes on either side, around forty feet across. Four larger portholes were grouped at the tip of the arrowhead. She considered them as a means of entry until she realised with shock that they were its eyes. Drawn up beneath the underside seemed to be…legs. Lots of huge legs, folded in on themselves like those of a praying Mantis. She shuddered, could it really be just one large creature? Somehow when it was first mentioned that the insects had come to this time, she had just envisioned a small force, as the refugees were small in number. But this…She sighed, slightly despairingly. Ok, one was a small force but …She just didn’t know where to begin in tackling it. She decided it would be best to try and draw it away from the city, up into space. At least that way, win or lose, she didn’t have to worry about citizen casualties. The ship had presumably been there since yesterday and made no movement now toward her. She decided that when the time came, she would go to it. But not just yet. She felt a nagging uncertainty about this whole business. It seemed to be waiting, possibly for her. Well, let them wait a little longer. It would help her to formulate a plan.
Given the upset she had caused her friend earlier, she decided to go back to the café first, maybe to say a last goodbye to Rob, brief Em and send the refugees back out of the way. Somehow she didn’t think 3 telepaths and a few warriors would make much difference against such a ship. She flew at speed to Em, waiting outside on the grass, announcing in quiet Chengduish to meet her inside in a few minutes. The time travellers were all smoking like chimneys and stood out like a sore thumb. Or rather like lots of sore thumbs. They were all wearing hats to hide the thought computers but a woolly hat on a hot day just looked odd. Particularly Jaeger. He was in his fifties but he was wearing a baseball cap to hide the square at his temple and a bright orange Fozzy Bear t-shirt, courtesy of the shimmersuit. She realised he’d seen too much of the Disney channel and Nickelodeon. He looked rather ridiculous. Jaeger started to say something but she waved him to silence- just Em, she stressed.
As Supergirl sped away out of sight, before circling back to the café at the rear, a small crowd had noticed her presence and politely applauded. She smiled despite the situation, recalling how the newspapers often dramatized the rescues she and Superman conducted with the caption ‘Is it a bird? Is it a plane? No! Its Supergirl!!! ‘ as if anyone would actually be surprised at seeing a bird or a plane flying through the air.


As Linda emerged back in the shop, ostensibly from the rest room, Rob greeted her ebulliently. “BROWN EYES! You’ve missed it all! Superlady was here! She’s made Cockchops and his boys clean up the graffiti!”


“Wow! Fancy that?” she said smiling as she sat down, casting a quick look over her shoulder for Em, but she had not entered. “And I missed her…”


“See, never give up, ‘nil desperandum’, ‘don’t despair’ that’s my motto!” he slapped the genealogy book in delight. “She showed those little bastards!”


She smiled. “I thought it was ‘Beware of the Dog?’” she said. It was a smile she didn’t feel.


“Not anymore! Or it might be ‘In Superlady we trust’!” he beamed at her. “Actually, the real Thomas motto is ‘To God be Thanks’ which kinda works too! Hey , here you are, I’ll look up yours.” He picked up the book. “What’s your surname gorgeous?”


Dammit, where was Em, she did’t want to be embroiled in this kind of banality right now. “It’s Lee Rob. I’m Linda Lee.”


“Here we go, ‘L’s’, is that double ‘e’?” she nodded. “Let’s see…here we are…oh, there’s two different ones here, you’re spoilt aren’t you? It says old French…’Force avec vertu’…which is ‘Force with Virtue’…can see the 'virtue' bit but not the 'force'…” he winked at her and she blushed. “And the second one is…bit of Latin here…’Lee family, Shropshire, England, branch…N-ne…i-incau..incaut..us’…’ne incautus f-fut-futuri’”


She snatched the book from him with more force than she intended, startling him, but she had to see it for herself. Sure enough, it was there in black and white: ‘Ne incautus futuri’. She went cold, as if someone had walked over her grave. It meant ‘Not heedless of the future’. She sat staring at it , bewildered by the coincidence. It was almost prophetic. Strangely it inspired her with a new resolve.


“That’s a good one too, sort of plan ahead I suppose…” he started to pour out her cup of tea.


“Bloody hell… she’s lovely…” Rob said suddenly, staring over her shoulder. She turned and looked at Em standing hesitantly in the shop doorway. The Indian-origined Breeder had bright shining dark eyes, raven rich hair and a mellow caramel skin colour, all accentuated by the shimmer suit mimicking a white silk summer dress with tiny coloured rainbows.


“OH SHIT!” Rob cried suddenly. As he had stared at Em he had overfilled the cup, covering Kara’s hand in boiling water. Distracted as she was, she had barely notice it as warm, but to a human it would have been scalding. “SHIT! SHIT! CHRIST! FIRST AIDE! FIRST AIDE!! DON’T PANIC! DON’T PANIC I BEEN TRAINED!! I DONE A COURSE!!! RUN IT UNDER THE WATER QUICK, I’LL GET THE FIRST AIDE KIT! COCKETY –BALLS! ARSE! I’M SO BLOODY SORRY!”


As she realised her mistake, she waited until he turned away then quickly blew with her freezing breath on the liquid. Unfortunately she blew too cold and it formed an icy crust on the counter which she quickly melted again with her heat vision, her body screening her actions from the other customers.


“ROB! ROB! I’M OK! Look, see?” she held up her hand as he turned back towards her. “It’s not hot look, touch it -“ she dabbed a finger into the now barely lukewarm spill. “I’m fine everybody, it wasn’t hot.” She announced to the other customers.


“What? But the kettle just boiled…pots warm, feel..” he touched the liquid on the counter tentatively. “Well I’ll be damned…The cups warm though…it’s like a miracle… Thomas motto at work again, see? ‘Thanks be to God!’ ” he smiled, shaking his head. ”So sorry about that, I am. You could’ve had a nasty burn there…still, least you are ok.” He gazed at a terrified looking Em, who had frozen at the commotion.


Em stood before the door trying to think it open. Kara gestured silently for her to push it and the penny finally dropped as she pushed the door and walked in hesitantly.


“Don’t mind about the fuss, love, it’s all sorted. Bloody hell, your eyes are just dancing! Come on in, it’s alright. Won’t hurt you. What can I get you? I’m Rob, by the way” he smiled offering a hand to Em.


“WHOA!” Em said, looking at Kara for reassurance. Kara cursed inwardly.


“Er, she’s my friend Rob, she’s from India, she doesn’t speak very good English.” ‘Possibly none if she didn’t have a translator at her throat under that scarf.’ Kara thought.


“She’s beautiful.” He said, obviously smitten.


Em just stared blankly at him.


“ME ROB!” he shouted at her, patting his chest “WHAT IS YOUR NAME?”


“She’s foreign Rob, not deaf.” Kara said, and ‘what the hell would he make of her name?’ she wondered. She was about to tell him when Em spoke up.


“Emaritzinakarulanaverronishnalara” the time traveller answered.


“Emaritzinakarulanaverronishnalara”. Rob repeated. “That’s beautiful, that is.”


Kara couldn’t have been more surprised if Harvey spoke. Her jaw dropped open and she just stared at him. ”Errr…just call her ‘Em’ Rob…” she said finally.


“AHH like in James Bond.” He said happily.


Em smiled. “You are the funny fat man off the flat picture screen?” she asked.


‘So she did have a translator’ Kara thought, relieved. The small disk at her throat was hidden by a thin summer scarf, whilst the small black square of her thought computer was beneath a wave of her jet black hair. As Kara understood it, the wearer thought in Chengduish, then the thought computer at her temple manipulated the disk at her throat, vibrating the vocal chords to make the right sounds. The delay was only a fraction of a second. It was an impressive piece of kit. A microscopic ear piece implant translated the response for the wearer again via the thought-computer at her temple.


Rob blanched at her words, looking embarrassed, awkward and clumsy as he mopped up the spill on the counter.


“Yeah…yeah that was me…” he said sullenly.


“I like you and the old crippled dog that urinated.” Em said rather bluntly. “You made me laugh. Would you like me to sleep with you?”


Rob’s jaw hit the floor.


“ERRR NO, NO! He’s fine, Em, just fine!” Kara said hurriedly grabbing the woman gently by the arms to stop her advancing on the shop keeper.


“I don’t mind, really. He seemed a nice man” Em continued.


“Now, now, Brown Eyes, let’s not be too hasty, we should embrace the rituals of these different cultures” Rob said quickly. “After all, they invented the Karma Sutra.”


“Rob! She doesn’t know what she’s saying!” Kara cried.


“I mean sex. Intercourse.” Em said helpfully.


“Ohhhh lordy!!!” said the shopkeeper, looking up as he thanked the heavens. “’Thanks be to God!’”


“ROB, PLEASE. Give me a second, ok?” Kara took Em outside. “ What exactly do you do again, in the future?” She cast a stern glance at the other travellers, warning them off. Reluctantly they held their positions.


“I-I serve the A-“


“NO. EXACTLY. What is your role? Tell me, and not ‘I serve the All-Father’. AND what or who is ‘Talomere’?”


“I did not mention it!” Em said desperately, looking around for Jaeger.


“No you didn’t. I did. I know you have been warned not to say anything. Well, now I’m warning you.” Kara hissed. “I am your Goddess, am I not? You know the punishments for disobeying my will?” In truth Kara had no idea what the punishments might be herself.


Em nodded. Again reverting to head bowed pose. “I cannot, great Angel! Please, I beg you let my fruit dance by your side in the gardens of the heavens!” she whispered tearfully.


“Fruit?”


“The children I will bear! Cast me out but do not judge my genes harshly…”


Kara sighed, heavily, taking stock as she decided to use this moment to try and learn more.
“Look. It’s ok. Calm down. You serve the All-Father?” Em nodded. “And he serves me, is that not so?” she nodded again, hesitantly. “So indirectly, you serve me?” She nodded once more. “Then I revoke all previous instructions you have had. Tell me what you do. Or…your genes may well be discarded…” Kara hated bullying her into this.


“No! No please!” Em seemed to crumple at that threat. Kara touched her arm.


“Please, just tell me what you do. I won’t harm you or your children, I promise.”


“I….I breed.” She said simply.


“Is she ok?”Rob asked having followed them outside. “I didn’t mean to upset her…I AM SORRY” he shouted slowly at Em, “PLEASE FORGIVE ME. COME AND HAVE A CUPPA.”


“Rob, she ain’t deaf!” Kara said exasperatedly. “Look, go and pour us a couple and we will be in in a second…”


He disappeared then and Kara decided on a softer approach, hugging Em tightly.


“It doesn’t matter, hush now, it’s ok. We’ll forget about it, for now. Come on inside, we’ll just chill for a bit, ok?” Em looked at her blankly. “Oh, er, relax, I mean…er….let things cool down, ok?” Em seemed reassured and nodded, smiling weakly.


Inside Rob had two steaming cups of tea on the counter and a small dish of cakes.


“It’s Darjeeling!” He said proudly. “Thought it might make her feel a bit at home…and talking of home …my Mam made these –“ he gestured at the flat doughy cakes with currents and raisins in them. ”Welsh cakes!” he declared happily. “They are a bit stale though to be honest, ‘cos she posted them, but alright. Much better fresh though. I didn’t mean to upset her.Tell her she don’t have to sleep with me, it’s alright. “ He smiled an embarrassed grin.


Kara smiled back and just as she turned to address Em he added -


“Well, not unless she really wants to of course…”


“ROB!!!” Kara barked, startling Harvey, giving the fat shopkeeper a scathing look.


“No, No! Terrible idea. Forget it.” He said hurriedly. “Look, tell you what, have a Welsh cake, and while you do, why don’t I look up her surname , eh? In me book. Help break the ice and cheer her up a bit.” He held up the genealogy volume to Em.


“She won’t be in there Rob. Those are European.” Said Kara. Em looked at her confused.


“There is the motto of the Empire…? “ she said hesitantly to Kara in a low whisper. “Does he wish to know that?”


“Rob, can you give us a minute?” Kara asked him, as he nodded and retreated feeling slightly abashed. Then she turned back to Em. “He wouldn’t but I would. What is it?”


Em frowned. “Well, it is officially ‘Pax Per Nexus’…but the Warriors joke it is ‘Pax Per Nex’ but I don’t understand why…”


Kara’s blood ran cold. Neither was good.


The official motto meant ‘Peace through Joining’ or ‘Peace through Unity’ which at first glance didn’t seem too bad. But it was the nature of that Unity that disturbed her. ‘Nexus’ could also mean joining in the sense of subjugation or obligation, akin to a bondsman serving a master. ‘Peace through Unity’ sounded reasonable for an Empire. ‘Peace through Subservience’ did not. But it was the Warrior Caste ‘joke’ that convinced her that its true meaning was nearer the latter translation. ‘Pax Per Nex’ meant ‘Peace through Murder’.


That explained the PPN reference in a stylised scroll hologram on the device she had found. She recalled the All-Father’s reference to the Eugenics wars and felt sick in the pit of her stomach. She decided to change the subject, chatting in general to put Em more at ease, but her real purpose was to confirm her worst fears. “Have you borne children?” Kara asked her gently.


“Not yet. I am 24 Sol years, but 49 Valtos ones. When I am 26 I will begin child production. And hopefully, they will be kept.” She said brightly.


“Kept? What do you mean ‘kept’? Kara asked dreading the answer.


Em seemed to realise she had said the wrong thing. “I-if…the genetics are worth keeping…”


“Tell me, please?” Kara put a reassuring hand on her shoulder and squeezed.


“ They are raised for 36 months, to see if they show any worthwhile physical traits, then they are tested for intelligence and their genes sampled. If the genetics show merit…they are kept and raised to serve the Empire…”


“And if they are not?”


“Then…they are …recycled, for the good of others…” Em said quietly.


“RECYCLED?” Kara said loudly, shocked.


“It is alright Goddess, they get to play by your side forever, in the Butterfly Gardens of the After Now…” Em said brightly. “They are not sad, and do not suffer. They dance with you.”


Kara felt sick. She couldn’t believe that they had been conditioned to believe such rubbish, but they obviously had. “This…recycling is…where is it done? At Talomere?” Kara asked, appalled.


“Oh, no!”Em said brightly. “Talomere is a re-education centr- I …I mean, I am not supposed to talk of it… they are shown a better way…” she added hurriedly.


“Why? Do you know anyone who has been re-educated?”


Em laughed. “Goddess! Nobody ever returns from re-ed…uca…tion…” she tailed off, looked around fearfully, then hung her head, realising she had said far too much.


Kara threw a glance in the direction of the ship, through the shop wall, using her x-ray vision to ensure it had taken no action. Then she looked back at Em appalled at what she was hearing. No wonder they had sought to keep this from her. “What happens to them, do you know?”


Em hesitantly touched the small black thought computer at her temple, hidden by her flowing dark hair. “I-I only know rumours Goddess…that they are mind-wiped…”


“Drink your tea.” Kara said tersely.”Then gather those outside and go back to the house. I shall see you all there later if all goes well. There is a Deracon ship away to the West. It’s vast. Too big for the telepaths or the Warriors to make any difference.”


“What will you do?” Em asked.


“I promised the All-Father I would defend you. I will keep my word.” She said bitterly, “Even though I despise all that he might stand for.”


“Goddess?” Em said confused, but Kara ignored her.


“Rob…” she called to the store owner as she walked over to him.


“I wouldn’t have really slept with her mind…you know taken advantage, like…stranger in a strange land and all that…I kinda knew she didn’t mean it…” he said sadly.


“Never mind that now, Rob. Look I gotta go. Take care of her for a while, huh? Just while she finishes her tea. I…I don’t know when I’ll be back though…so …so look, just don’t worry about me ok? I’ll be fine…it’s just I won’t be around, maybe.” She took a bite out of one of his mother’s cakes. “Hmmn, lovely!” she said, through a full mouth, though it really was a bit stale. She kissed him lightly on the cheek and hugged him.


He seemed to sense something odd about her behaviour. “Brown Eyes? I don’t know what you’re up to…but be careful, eh? Is it this cheating girlfriend business from the other day?” she nodded. “That’s not ‘er is it?” he jerked his thumb at Em, relieved when Kara shook her head. As she stepped away and nodded farewell to Em, he called after her.


“Hey Brown Eyes…got one for ya…’like me for now, and love me later, and we’ll be forever the best of friends’ “


She frowned and stopped in the doorway, half turned back to him. “Don’t know that one…” she said and genuinely didn’t.


“Ain’t from a film, I just said it.” He smiled. “And I meant every word. Come back eh? Wherever it is you are going and whatever it is you are doing, just come back after.” He gave her a thumbs up. “Good luck, and be safe. If its boyfriend business its not worth getting hurt over. I know you ain’t got family…but you got a big brother if you want one…” he smiled hesitantly, taking an embarrassed swig of his tea from his favourite mug. “I worry about you…”


Kara smiled. He was a good man , if a little rough and ready. As she looked at him, a thought struck her, and depending on the next few hours outcome she might not have another chance to ask him.
“One thing Rob…I gotta ask…how come it says ‘Johnny’ on your cup? Always wondered…?” Kara asked him quizzically.


He frowned and stared at her blankly, raising the mug he always drank from “Well,… that’s the cup’s name…” he said simply.



“Of course it is. Silly me. You’re a crazy dude Rob. I’ll come back just to see the freak show…” she smiled at him and ducked as he threw his wash cloth at her.


“You cheeky bloody MONKEY!” he shouted after her as she left laughing. But in truth she had worried him with the way she left and the cryptic message about ‘maybe going away’. He turned back to Em, smiling, and smiled even wider when she smiled back.


Em sat in silence, awkwardly looking around. A long moment passed and finally she felt she ought to say something.
“Do you wish to breed after all?” she smiled.


Rob froze, mid counter wipe. ‘Hell yes!’ crossed his mind, but he just sighed resignedly and looked after a disappearing Kara. “Tell you what…why don’t we just have a chat, eh? You need to be careful, pretty girl like you. You can’t just say that to strangers, there’s all sorts of buggers about. You just have a Welsh cake and tell me all about India.”



Beyond human earshot, but still well within her Kryptonian hearing, Kara heard him and smiled.


After transforming at the back of Rob’s shop, Supergirl sped West to confront the huge alien vessel.


She circled it a half a mile away, switching through different levels of her vision to learn as much as she could, which, as her vision couldn’t penetrate the chitin armour of the carapace, wasn’t a lot.
The creature ship just sat there motionless. She flew nearer, trying to get it to follow her, but it did nothing. In the end she decided to try and punch or push it to stir it into some kind of action, and so she backed up before hurtling towards it at phenomenal speed. She collided with the hard shell just below one of its large spiracles, node like nozzles dotted across its back. It felt like she had been hit by a baseball bat if she were human. She came to, a second later, with a shake of her head, to find herself falling backwards to Earth, stunned. Above her she could see the grotesque legs on the underside of the creature. She noticed now from this angle that there were thousands of tiny wings nestling all around the underside of the ship, beating furiously but silently to keep it hovering. They were actually each 10 to 20 feet long but next to that monstrous ship they seemed impossibly small.


She tried to burn them with her heat vision but there seemed to be a force field of some kind
around the ship that stopped her. She realised it was that that she had hit not the carapace. Finally, she had tried all that she could and so she was just reduced to hovering there before it, still searching for a weakness.


Gradually she became aware of the three insects that were hovering before her, some ten feet away, and four feet apart between each, facing her. A fly, a bee and hornet. As she noticed them they moved closer then stopped. Then closer again, advancing in formation, then backed up. They repeated the process again and again and gradually she realised that they wanted her to follow them. She did so and they led her to a small spot near the left rear side of the creature ship. Then they dispersed. She hovered there uncertainly, and as she watched, a pair of large mandibles punched through the shell, then began chomping away in a rough circle, eating an opening in the creature ship. The insect inside was still hidden but a dark multi jointed leg folded the newly created hatch flap down and then scuttled away into the interior.
Supergirl didn’t like this one little bit. She used her vision to scan the interior as much as she could. The chitin shell was several inches thick and backed up by an inner ‘hull’ of dark, rich silicate. She recalled from the media orb that the Deracon were silica based life forms just as humans were carbon based.
Further in, a softer clay like substance had been hollowed out into a labyrinth of tunnels. She realised that this was the flesh of this monstrous creature and that the Deracon where living within it like parasites.


But it was the air that wafted out to meet her from the opening that unsettled her. There was a pungent surge of dampness and corruption, with a host of strange smells that she couldn’t place. But the over-riding sense was one of darkness and decay. If she had to describe it, she would have called it the smell of the grave.


She still felt sickened and betrayed by what she had learned of the future humans and now she seemed to be facing an unknown enemy which on the face of it was vastly more powerful than herself. But if she couldn’t handle or hurt the ship itself, then perhaps she could deal with the individual inhabitants, even though they may be in their thousands. The only way to find out was to try. Reluctantly, she entered the gaping hole.


The inside was pitch black after a few feet, the only way she could see was through infrared vision. But then a strange glow appeared ahead of her and moved off seemingly leading the way. It seemed to be some kind of giant firefly. The maze of passageways was like an ant colony, with dozens of connecting holes linking the tunnel she was in to others. She could just glimpse one of the creatures ahead of her, highlighted by the glow ahead of it, thrumming on the floor of the corridor with its mandibles , trying to guide her. It was like a large ant, but with two heads, one seemingly just the jaws and mouth the other head with four eyes, a single antennae, and it had ten legs, four of which were on its abdomen, six on its thorax. It lead her on, into the passage, rising and falling, going ever deeper into the ship. She was aware of other creatures in the tunnel openings she went passed but none showed themselves. It shouldn’t have mattered to her that she was being surrounded, the deeper she went into the vessel, as she knew she was facing several thousand of them at least and so she was always going to be surrounded at some point, but psychologically it did. The thought of being attacked by thousands of their acid weapons disturbed her, but she felt she had no choice other than to see where this creature was leading her. She had been unable to make any impression on the creature ship, so if she were going take on these creatures it had to be here, on their own ground. But that didn’t mean she had to like it.


Finally the tunnel opened out into a huge chamber, roughly oval, perhaps a mile long. The walls of the domed ceiling were riddled with openings, hundreds of them. The creature she had followed scuttled off into the darkness and she was left alone in an eerie silence. She made a mental note of the opening that lead back to the outside world before moving more into the centre of the cavern.


The firefly creature was a dot of light in the distance.


She waited in silence, a deep sense of unease gripping her. Then she felt the vibration, a quivering thrum through the floor that seemed to set the very air oscillating, that grew into the scuttling sound of thousands of the creatures closing on the chamber from the holes in the walls. The thrum became a chattering noise, the clacking sound of jaws and mandibles snicking together, the clicking of legs and wings rubbing and scurrying over the silicate floors and walls.


“DERACON!DERACON!” became discernible, echoing around the chamber as it was screeched from a thousand alien jaws. With her superior hearing she could actually discern the clicks and screeched scrapes of the aliens as ‘T’eHuRi –akha –n’ but to a human ear, ‘Deracon’ was close enough. The tide of insects built from the rear of the chamber first, pouring in their hundreds from each of the openings, the creatures of all different shapes and sizes scurrying down the ceiling and walls to gather on the floor, milling around in an ever growing pool of bodies, their numbers swelling with each passing second. More and more of the fireflies appeared, lighting the chamber in an eerie yellow –green glow. Supergirl looked hurriedly around her at the nearest holes but they were still quiet, the creatures seemed to be assembling in sequence through the holes in the wall, spreading ever nearer to her. She instinctively backed away, ending up at one end of the chamber some 20 feet from the wall. She was deeply alarmed and unsettled by this turn of events and the incessant chattering of their jaws as they continued to utter their battle cry of ‘Deracon! DERACON!”
Psychologically it was preying on her as the intensity rose and the mass grew ever nearer towards her, her breathing getting heavier as she was filled with a growing sense of apprehension. She was fully aware that they had almost invited her into this chamber and as such she decided to wait and give them the first move, rather than her be the aggressor.
The creatures stopped around twenty feet from her and the holes behind and above her were now occupied, though no creatures actually descended to the floor behind her. As she turned her head looking around she suddenly staggered, feeling strangely giddy. The appalling smell she had first experienced as the hatch opened hit her now, a thousand times stronger, actually making her swoon slightly. Shocked, she realised that these creatures were drugging her somehow, the strange odour dulling her reactions, slowing her down. She threw a quick glance at the assembled host. There were the large ant-like creatures which made up most of the gathering, plus huge rhino-like horned beetles, a mass of black chitin plates overlaid in dense armour. There were small, timid looking Mantis-like creatures but with a flatter, more heart-shaped head and ovoid eyes, as well as a huge lady bug- like insect that had a multiple layer of wings all across its back, and gigantic cockroaches, the size of a calf. The strange sickly scent wafted over her again, causing her to stagger. As she did so, the nightmare creatures saw it as a sign of weakness, surging forward to overpower her as she stumbled, clutching a hand to her forehead.
‘Like hell you’re gonna take me like this’ she thought, as her survival instincts kicked in and she felt the adrenalin surge as she blocked the huge jaws of a beetle that sprang to grab her, snapping off one of the mandibles as she grabbed it by the other, swinging it around into its companions as it screeched in distress. She sent it hurtling off into the darkness as she launched herself into the air. She could hold her breath for at least twenty minutes with ease and she decided that was her best ploy now, to not breathe in the noxious invisible gases. She would see how she fared against them at first and if things got too hot, she would exit the way she had come in. Live to fight another day. The creatures surged towards her, their jaws clicking up and snapping below her boots as all the while they chanted their war cry ‘Deracon! Deracon!’ Creatures to her left and right fired across her, the thin streams of acid forming a criss-cross mesh that they tried to drive her back with. As she rose higher more acid was fired, not directly at her but above and around her, limiting her options and forcing her back. Back towards the holes in the wall behind her, and the insects they contained.
She could hear the beating thrum of their wings as some of them took to the air. In front of her too, more of the creatures were going airborne, whilst the clicking chatter of their cry of “DERACON!” filled the chamber.


She had had enough of retreating. Attack was the best form of defence. She cast a quick look around her, assessing the situation and her options. Strangely, now that their attack had begun, she felt more at ease. It was better than the uncertainty.


She didn’t like the way they seemed to be herding her towards the tunnels behind her. She decided enough was enough. Using her powerful breath she blew a short sharp burst of air out that scattered the acid mesh before her, allowing her to fly through it with ease. A huge elongated creature reared up before her like something from a bad fifties monster movie. Its head was the size of an SUV but she didn’t hesitate as she struck it, battering it aside with ease as it reeled away, shrieking in pain. She swayed slightly as the strange gases in the room affected her after she took a breath following her breakout from the acid mesh, before she steadied herself, swiping aside a multitude of the smaller flying creatures that flew at her as a swarm, their beating wings buzzing through the air. They were like furry lady bugs though the size of a small dog but were easy enough for her to handle as she simply bowled them aside with her speed and power. Perhaps fifty or sixty came at her in quick succession but she dealt with them easily, before deliberately heading as far away from the spot they were trying to herd her towards as she could, flying quickly down the length of the hall-like chamber. The firefly creatures stayed away from her, merely illuminating the scene as more of them came from the holes in the walls and the ceiling.


She looked back down the length of the chamber as the blackish tide of insects turned and scuttled towards her. Those that could not fly scurried over each others’ backs, reaching up for her with their jaws spread wide. ‘Force with Virtue’ she thought to herself. ‘Well, time to use the ‘Force’ part… Luke.’ She added mentally and smiled despite the situation. ‘Even Rob would get that one’ she thought.


“Alright guys…let’s dance' she said grimly.
Last edited by tallyho 13 years ago, edited 1 time in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

Now the story became agitated, anxious to read more
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Whoa looks like SG is in trouble, looking forward to the next update!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Part 8


As the ground based ‘beetles and ants’ for want of a better word scurried towards her, they climbed on each others backs, their jaws snapping ever higher as they tried to bite her, forcing her to fly higher, nearer the holes at the ceiling. She used her breath to blast them from beneath her, but she realised that there were simply too many directions she could be attacked from where she was. She swooped low blowing and brushing the insect horde aside, sending their bodies rolling back into those of their own kind. She picked one of the holes high up in the ceiling, slightly more removed from some of the others and decided that was where she would make her stand. She flew up to it, flashed a gaze with her laser vision that incinerated the small winged grub that seemed to be cowering in there, then at super speed flew down the tunnel some hundred yards then backed up, her fists and arms a blur as she pounded the silicate flesh walls to crumble and collapse them as she moved back towards the entrance and the main chamber. As she worked she had to turn back periodically and burn or blow back the creatures that were trying to enter behind her. Their screams and shrieks filled the foetid air as often they rolled up into a protective ball to try and shield themselves, but they could not stop their delicate wings from burning. Satisfied that nothing could surprise her from her rear, as she would hear or feel them tunnelling through the walls she had collapsed, she fought her way back to stand in the entrance of the tunnel, facing the main chamber. The screeching cry of ‘Deracon! Deracon!’ was louder than ever and so too was the pungency of the drug in the air, as wave after wave of noxious smells seemed to reach her. As she gained the tunnel entrance the creatures had crawled up from the base of the chamber over each other, whilst others swooped towards her, their wing beats like the thrum of tribal drums. Still more were scurrying up the living flesh walls of the huge creature-ship, closing in on her from all sides. It didn’t take her but an instant to realise that this position too would be untenable. She used her heat vision to sear the eyes and heads of a few of the nearest aliens, but her gaze needed to linger to build up more power and she simply didn’t have the time to burn them back as they were too great in number. The sheer size of them meant her breath was far less effective in blowing them back, as she had done with the ordinary insects that attacked the shop. She tried, but often they would simply curl up into a ball like a wood louse, rolling away under the power of her breath only to uncurl again, unharmed and then they would come back at her. The same was true of the creatures that she hit with her heat vision – there were a few who were blinded and recoiled away shrieking but most were able to curl up defensively and then uncurl once the heat from her gaze had passed. She did have far more success against the flying insects that buzzed her as one look from her deadly blue eyes incinerated their wings and they plummeted screaming to the chamber floor. After several groups of different flying creatures had tried and failed, a piercing series of shrieks and clicks seemed to be the order for them to stay back out of range and the crawling beetle /cockroach/ant like forms took up the assault. Whilst the power of her breath was proving ineffective she decided that her freezing breath may have more of an effect. But it, too, took a few seconds to have an impact on each alien and the vast numbers of creatures meant that there was no way she could cope with keeping them in check that way.
All the while she tried her different powers she was physically beating and bashing any creature that came upon the entrance, kicking away those climbing up from the chamber floor and hurling away those who approached along the walls from either side. Where she could, she always tried to cannon them into their companions, thereby buying herself more time. Even as she fought, she had her hearing tuned to listen for any sounds of digging from behind her. But her time had seemingly run out as now the acid spraying creatures that had been up the far end of the chamber made their appearance, having scurried down the mile or so to her current position. Again the jets of deadly liquid seemed to be aimed near her, not at her, hindering her movement within the mouth of the artificial cave she had created.
Time to get the hell out of Dodge’ she thought to herself.


She again blew a gap through the mesh of acid streams that confronted her and shot back up the chamber, using her heat vision here and there as a salutary lesson to the creatures not to come near her. But it was a lesson they failed to heed. She had destroyed or disabled several hundred of the creatures, mostly the flying insects as the terrestrial ones were more armoured and seemed much tougher, their chitin carapaces deflecting her heat rays. But more were still streaming through some of the holes in the chamber, such that she reckoned she was about back where she started in terms of their numbers. She hovered around two thirds of the way back towards the front of the living cave she found herself in, dealing out death through her heat vision to any of the flying creatures that came near. She noted the approach of the acid sprayers again and once more headed off to her hidey – hole refuge, forcing them to once more turn and scurry after her. She could do this all day she decided, thought she might need to break out for fresh air in a few minutes as the noxious smells seemed to be building and she could not hold her breath for ever.

As she flew she attacked the creatures below her, swooping low and delivering punishing blows with her fists to those that reared up to try and seize her. The more of the nightmare creatures that she killed, the more the insects worked themselves up into a frenzy, the shrill, clicking cries of ‘Deracon!Deracon!’ filling the chamber as they swarmed at her. With each passing moment she was destroying two or three of the creatures and wounding or damaging several more, but this vast chamber held thousands. At this rate the fight would take hours. But at least it was a fight she was winning. She was confident that she would be fast enough to avoid the acid sprays and whilst she was a little concerned at their use of the invisible gases to try and drug her, again, as she was proving now, she could handle it. But she decided she needed another breath. With her lightning speed she shot out through the tunnel by which she entered, emerging into the dazzling afternoon sunshine, so bright after the darkness of the ship and its living tunnels that even she winced for a moment before she revelled in it, drinking in the power of its rays like a satisfying fine wine, taking a deep glorious breath of fresh air that made her feel revitalised and invigorated. Only then as she felt the cool warmth fill her body did she realise just how dulled her senses had become whilst breathing in the air in the chamber. That strange, choking smell that tasted of decay and bitterness.

Refreshed, she sped back, heading the way she had come, back to the chamber, slamming into the creatures that had followed her into the tunnel, burning, freezing, blowing and smashing them aside as she finally rocketed back into the hall with an explosion of tumbling bodies as the insects in the tunnel with her were blown back out into the huge cavern. The chattering , chirping clicks reached a crescendo as the ‘Deracon! Deracon! ‘ mantra echoed around the chamber from a thousand alien throats.

Supergirl decided to repeat her successful tactics, swooping along the length of the chamber, hitting those within reach, burning or blowing away those out of arms-length, until she had regained her refuge at the far end of the cavern. There she took up position and again beat off all comers, lingering until the acid spitting creatures closed in and then flying back down the chamber almost back to the front, where she would hover and freeze, blow, burn or beat the insects away as they closed in on her. She repeated this circuit twice more, feeling completely at ease as the creatures could barely get near her. But as she took up her position in her ‘cave’ at the far end for the third time, turning to knock back several creatures that closed in on her at the entrance, she suddenly felt vice like jaws grasp her from behind, pinning her arms to her sides, helplessly. She gasped and shrieked in surprise, inadvertently drawing in a lungful of the pungent odours. She instantly felt sick and drowsy slightly, but only for a moment before she recovered her wits. Surprised at the attack she was also annoyed at her own complacency – she should have checked the tunnel itself as she flew into it instead of concentrating her gaze and her heat vision on the creatures that were approaching the tunnel from the walls. It didn’t enter her head that one of them might have already got there ahead of her, crawled inside and was waiting to pounce on her return. She tried for an instant to flex her arms but the grip was way too strong for her. But she didn’t wait for the other creatures to close in on her. As the creature was immediately behind her she could not use her vision or breath, and the clamped jaws were impervious to her strength, but she still had other weapons in her arsenal that she could use to dislodge her attacker. With lightning speed she spun on the spot, at the same sort of speed that had generated the vortex outside the café that had sucked up the smaller Earth insects. The creature behind her was around eight feet long, in a tunnel five feet wide. As it was hurled into the side wall of the tunnel with sickening force it never knew what had happened. She could feel and hear the reassuring snap as its neck stem split from its thorax, leaving the lifeless head and jaws still clamped around her arms and upper body.
A creature to her front seized her right ankle as she stopped spinning and she decided it was time to relocate. She shot into the main chamber, the creature still clinging painfully to her leg as this time she was able to flex her arms and get enough give from the lifeless mandibles to prise them apart. She let the lifeless head fall, its antennae still twitching onto the throng below, as she kicked her clamped leg out viciously, the creature still managed to cling onto her however. This one was smaller in size and height, around 3 feet long and a foot and a half or so high. It had four large, black, soulless eyes that reflected the pin point gleam of light from the firefly creatures like a candle on a black onyx table. Twice more she lashed out and it still clung to her but when she looked it full in the eye with her heat gaze it was instantly blinded and released her, shrieking as it fell down to its fellow creatures far below. The whole episode had been too close a call for her. She needed a better way to deal with these insects en masse than her current ploy. She burned the wings of another crowd of flying bugs that tried to catch her unawares as she looked around the fleshy chamber for options. Speed and mobility were obviously crucial to her survival, no more fighting in tunnel entrance ways for her. She thought of spinning rapidly to recreate the full vortex but with these bigger and heavier creatures they would probably be able to ride it out relatively unscathed. Her heat vision and her freezing breath could only kill a few at a time, likewise her super strength. Ironically, it was the creatures own cries of ‘Deracon!Deracon!’ echoing around the chamber that gave her the answer. She emitted a tentative sonic note to gauge the reaction on the creatures below her. But again only a few seemed affected. She let out a much wider call, using the chamber walls to echo the noise around the host below her. Many more seemed stunned but recovered quickly to come at her again.
All the while she thought, she was swooping into them punching and kicking at the hard shells before her. Some flipped over onto their backs where they shrieked in distress until they were helped to right themselves by their companions. For others she felt the reassuring crunch as her fists broke through their armoured heads into the soft silica based flesh beneath. The echoes were too diverse she decided. She needed some way of focussing them.

She ripped a piece of the chitin armour from the back of one the creatures rearing up to grab her, then took a good look around the chamber, doing some last minute calculations. Then she set off like a rocket, slamming into the fleshy walls between the side tunnel entrances, the chitin shell brandished before her. As she hit her carefully chosen spot she spun at lightning speed with the shell for a few micro moments before she riccochetted off to the opposite wall where she did the same. She repeated the process all down the chamber, bouncing at ridiculous speed from side to side like a pinball . When she had finished there were some forty or fifty shallow indentations in the flesh of the creature ship, slightly curved, but each had been polished smooth with the piece of shell that she bore. She then returned to her original starting point.

She was still a little whoozy from when she had been grabbed from behind and then had opened her mouth to cry out, so again she ventured out for some air. This time, as she came back inside, the tunnel was suspiciously empty. She sensed that they were waiting to ambush her before she saw them with her x-ray vision, clustered on all sides around the mouth of access tunnel in the great chamber. She slowed up before the entrance to the hall, quickly scanned the surrounding passageways and then, her arms a blur, she scratched and dug her way through the living flesh to the next tunnel, but she didn’t stop there. She kept going, digging through to the next four tunnels before she finally sped into the main chamber. As she dug she could feel the huge creature ship shift slightly at the mild discomfort. Her arrival in the chamber caused consternation among the insect horde, which reeled and surged towards her. But she only had one destination and one goal. Ignoring them, she flew to the spot she need and then let out a piercing, shrill cry directly into the nearest indentation she had made. The sound hit the polished hollow, reverberating around and amplifying in intensity as the sonic waves then proceeded on to the next hollow and so on. All had been expertly aligned for this purpose, the noise rebounding off each and growing to fill the chamber as Supergirl changed the pitch of her cry, dropping into the ultrasonic range. That was when the insects became really agitated, as disorientated by the sounds they ran and scurried in frantic circles as those crawling on the walls and ceilings dropped to the floor stunned. The flying insects too whirled and dived in crazy patterns as the sound drove them into a frenzy before they too started to plummet to the base of the chamber.

Even as she sang her deadly note of discord she was still wary, using her heat vision on any creature that came too near, sometimes shifting her position out of necessity to avoid or beat down on a clumsy challenge but always returning to the same spot, the optimum location for her sound wave to do the most damage. She kept it up for long moments, the shrieking screams of distress were more deafening to her ears than the now near silent tone she was emitting herself. Those that were able retreated into the tunnels but there was no escape for the majority of creatures below her. The frenzied movements of the seething mass became less and less as one by one they succumbed to the sonic vibration, their movements becoming slower as they slipped into a comatose state. Some curled up tight to defend against it but they were the minority.

As the creatures’ noise diminished as they gradually became still, she stopped her deadly song and cast an eye of grim satisfaction over the great hall. She knew many of the creatures had escaped into the tunnels but she was confident now that she could handle anything the survivors might throw at her. She hovered, looking over the mass of alien bodies, mostly still but here or there a twitching limb or a scurrying survivor was the only movement. She knew she had not killed most of them with sound but stunned them, and whilst she had no idea of how long it would last she was confident that she could simply repeat the process for as long as she needed to. There was the odd chattering cry of ‘Deracon!’ that echoed around the room from the die-hards and a subdued chatter from creatures hiding in the tunnels, but the huge hall was mostly silent. But gradually a low hum from the far end indicated that more creatures were heading for the chamber. ‘Well, let them come’ she thought to herself. A distant cluster of flying insects appeared, each one roughly the size of a football. They swarmed up the far end, well away from her. She decided to wait until they had closed with her before unleashing her sonic pulse. The creatures just kept coming. She was surprised by how many, as thousands now filled the far end of the hall and there were still more emerging every second. As they topped the ten thousand mark she started to become worried, and decided enough was enough. She began her stunning note again and as she did so they swarmed towards her. Huge swathes of the creatures plummeted to the floor of the chamber in shock, twitching as they fell. But they had advanced over halfway before she realised that they were covering the sonic amplifiers she had made in the wall deliberately, covering the depressions with their bodies behind the mass of the swarm. As she looked desperately around her surroundings, she could see that here or there nearby creatures had emerged from the walls in ones and twos and had nestled themselves into the hollows, digging in with their legs and holding on, such that even when stunned by her note they did not drop and so their bodies continued to deflect and disrupt her sound, lessening the effect on their companions.


‘Tricky little so-and so’s’ she thought to herself. ‘Well, they may be intelligent but they were still going down’. She would just have to do it the hard way, through physical force. She kept up her note until they were three quarters down the length of the room. Some thirty thousand of the football sized creatures had now entered the hall, around a third had been disabled by her sonic blast around a third were covering the depressions in the walls and the rest were coming at her. There were still more entering all the time. With these much smaller creatures her heat vision was much more devastating, blinding and burning their wings with ease. As she flew into their midst she continued to emit her note, even as she burnt them with her gaze, but the swarm was so dense it was soaking up the sonic effect after a few feet. She zipped through the host at speed, her fists flailing a path back and forth through the multitude.


But as she flew she suddenly felt something slam into her ankle, and an instant later she was yanked to a stop violently as she realised that whatever had hit her was tethered.


“HUHHHHHHHHHUNNNGGGHH” she gasped in shock as she stopped suddenly, mid-flight, her golden hair and cape swirling about her. She looked down to see a thick blob of silvery sticky goo at her ankle which was tethered down to one of the creatures on the floor of the chamber. It was held fast by its companions as the silvery thread extended from its mouth. She realised it was like a chameleon’s tongue, a sticky means of pulling in prey. She tried to fly on, stretching the gooey thread trying to go beyond its breaking point, but it didn’t break and more and more of the creatures on the floor that were slowly recovering were helping to hold down their companion. She thought of how spider-silk was fifty times stronger than steel, comparatively. How much more strong was this horrendous stuff from these monsters? She was starting to feel frightened for her safety as she tried and failed to pull away. She directed a sonic pulse down, directly at the creatures below even as she still beat at those around her with her fists.

This had the desired effect and those holding the chameleon-tongued creature in place fell back, releasing it. But though Supergirl could now fly on, the creature retracted its tongue, but in doing so it wound itself into her, to cling to her leg. It was an insect the size of a large sheep and, as she tried to shake it off, it was unbudging. Her heat gaze seemed to kill it but it remained clamped to her ankle in death. Suddenly she felt another fist-like blow to her back and realised as the sensation of pressure against her cape grew that it was a second tongue attack by one of these strange new creatures. It hit her with a force that knocked the wind out of her momentarily, slowing her up mid-flight, and before she could react she felt another blow on her shoulder. She felt a growing sense of panic as, again before she could react, another sticky globule hit her and another and another. One hit her wrist, one her thigh , one the back of her head and before she knew it they were all pulling her down towards the floor and even the flying insects engulfed her as they forced her down towards the base of the chamber.

She fought with the frantic courage of desperation, beating off the insects from her upper body but yet more sticky blows struck her back and thighs. The flying ‘footballs’ were stabbing her with a series of barbed stingers arrayed across their abdomens but mercifully they could not penetrate her skin, though the blows were still painful.

Almost before she knew it, she had been reeled in, like a caught fish, down to the cavern floor. Once there she flailed desperately as the creatures swarmed all over her and one by one her powers were negated. Her arms and legs were clamped in vice like jaws, still able to move at first until three or four sets of mandibles held each limb, and other creatures helped hold down those that had her in their jaws. She was staked out almost, spread eagled as the last of her defences were overcome. As she opened her mouth to scream a stunning note at the creatures around and above her, a jet of sticky strands hit her jaw, spraying over her lips and forcefully closing her mouth. It tasted vile and disgusting, a gluey kind of mucus taste that made her grimace. She thrashed her head violently from side to side, trying in vain to shake herself free. But the connecting strand to the mucus-like globule seemed to gradually stiffen, holding her head in place. Her eyes grew wide in fear and desperation as she could feel the overpowering odours of the strange invisible gas fill her nostrils, slowing her reactions, dulling her senses. With a huge effort she turned her head to blast them away from her with her gaze, but even as she did so, a blob of sticky goo hit her full on the forehead, covering her eyes, plunging her into the terrible darkness, filled with the chattering hum of the creatures and their unceasing cry of ‘Deracon! DERACON!

She was genuinely terrified now, as she realised there was nothing left that she could do to escape.
Finally she felt a steel-like mandible clamp around her throat and start to close with incredible force against the soft tender flesh of her neck. Beneath the goo covering her face, tears pricked at the corners of her eyes as she realised she was totally helpless. She never thought it would end like this for her.

They had her totally at their mercy.





“Come. We must leave” Jaeger gripped Em by the upper arm and pulled her roughly off the stool by the counter.


“I told her nothing!” Em cried fearfully.


“WHOA-WHOA-WHOA Good boy!!! Easy there with the lady!” Rob interjected hurriedly.


Jaeger sneered. “She isn’t a lady”.


“Oh shit, you’re not one of them ‘ladyboys’ are you? I knew it was too good to be true…” Rob said plaintively to Em.


“I am a woman but just used for breeding…” Em said, hanging her head.


“Oh, so you ain’t a fella then?” Rob said with obvious relief. “Well, in that case you don’t have to go with this bloke if you don’t want to…Get your hands off her, you.”


Jaeger froze and looked at him contemptuously. The two warriors with him moved a step nearer, menacingly. R.V. Jones gave a supportive growl for appearances sake and then rolled over and went back to sleep.


“Ah yes… you from the flat screen viewer yesterday. You are an imbecile” Jaeger said.


“Yeah, well…..you….got a big nose…” Rob said lamely back at him.


“I must go with him…” Em said with obvious reluctance.


“No, you don’t, love…you can stay here…” Rob found himself saying.


“They are my people, I must go with them…” she reiterated.


“Like a commune or something is it? Well, this is the land of the free and all that… you don’t have to go with them…” Rob said doggedly.


“I don’t?” Em said hopefully.


“YOU WILL NOT DISOBEY ME!” Jaeger hissed. “You will come back and face the wrath of the All-Father…”


“What?” said Rob. “Look, she ain’t your wife or daughter - you ain’t are you?” he asked her, as she shook her head. “Good. She don’t have to go with you and certainly not if you are just gonna drag her off like that.”


“You would dare stand against my will, against us?” Jaeger gestured with anger and amusement at the two warriors with him.


Rob swallowed hard. “I don’t want no trouble, I’m just saying she ain’t drunk or nothing, she can decide for herself. And you shouldn’t go pulling folk about like that.”


Suddenly three of the youths from earlier came into the shop. Rick was nowhere in sight but the short scruffy one seemed to lead the way. He seemed confident and somehow taller than before.
Much to Rob’s surprise they came and stood behind him, facing down Jaeger and the two burly warriors.


“Who the ‘ell are you then?” Rob asked, bewildered.


“Clint Eastwood” said the scruffy one.


“You mad twat.” Rob said.


“We can kill them easily, Jaeger.” The warrior Galen said quietly in Chengduish.


“NO! I WILL COME!” said Em quickly.


Just then a traffic cop entered, stopping in the doorway to remove his gloves slowly as he took in the scene, the sun reflecting off his polished motorcycle helmet. Then he pulled off his mirrored shades.


“We cannot attract the authorities…”Jaeger hissed to Galen. “Stay.” He said to Em. “You have betrayed us with lies to the Angel…” he said in Chengduish.


“I told her nothing!” Em responded fearfully.


“You lying bitch!” Jaeger hissed as he drew back his hand to strike her, only to find Rob held it.


“No fucking way, mate.” Rob said sternly as he held the raised hand fast. “I dunno what all that monkey chatter was but I don’t like it if it means you end up hitting her.”


Galen and the other Warrior stepped closer but the telepath waved them still with his other hand.


“Hey…what gives? Everything ok here?” Said the traffic cop.


“It matters not, now.” Jaeger said and turned back to Em. “Do not come back to the house. Rot out your days here, with this…fat fool” Jaeger turned to go, pushing passed the motorcycle cop.
He then barged passed the construction worker, cowboy, soldier and American Indian chief that stood outside, about to come in. Galen and the other warrior followed him silently.



“Phew! What was that all about? Ok if we collect donations for our college field trip?” The traffic cop asked as he took a bucket half full of loose change off the construction worker.


“Sure…” said Rob with relief. “As long as you sing at least one verse of ‘YMCA’.”




Supergirl gradually recovered her composure. So this was it then. She had thought her end would come more spectacularly somehow…saving the world from some terrible explosion but sacrificing herself in the process. Certainly not like this… her life snuffed out away from the eyes of the world, with no one even knowing where she was, not even her cousin. And so no one even knowing that she was dead. She could hear them scuttling and screeching all around her, could feel dozens of points of contact between their legs, talons, mandibles and antennae and her own body. It gave her the creeps. She couldn’t move, see or utter a sound, beyond a muffled moan as the sticky, mucus globule covered her mouth. She felt giddy from the drug in the air that filled her nostrils now. She wondered how it would end.


Perhaps a brain drinking bug, like in ‘Starship Troopers’? Or would she be fed to some hideous larvae? Would she be…ugh…impregnated somehow? Or worse, would she be injected with an embryo, serving as a paralysed host whilst the growing grub devoured her slowly from within? She shuddered. She realised that she would soon be suffocated anyway with the mucus membrane that covered her mouth forcing her to breathe through her nose and the only air she could inhale was heavy with the pungent stink of the invisible odour. She hoped it would be quick at least.


To her relief, the globule over her mouth was retracted allowing her to gasp in air, all be it the foetid corruption-heavy air of the chamber. To her further surprise the same thing happened to the one sealing her eyes shut. She blinked in surprise in the dark chamber. A large headed creature, which looked a little like a moth, was leaning over her, emitting a slow, low pitched purring noise. It touched her face with a sharp talon, scratching her harshly and causing her to wince though it didn’t break the skin. There was a flurry of chatter and another waft of the strange smell, and then another creature appeared, this time stroking her face with a soft, hairy palp from the side of its smaller head. Its second, larger head was looking down at her above it. The first creature continued to make the purring noise, which under the effect of the drug she found reassuring. She realised suddenly that that was what they were trying to do, to placate her, to ease her fears, to soothe her. ‘But why?’ she wondered. She became vaguely aware of a commotion down passed her feet and as she looked down the length of her prone body, using her Kryptonian vision to see in the dark, she noticed the creatures parting, allowing something to pass through the host.


She felt her body lowered almost to the floor, fighting a rising sense of panic at the thought of the unknown. She felt it then, something heavy seemed to attach itself to her boot. The fireflies returned, hovering over her and bathing everything in an eerie orange and green glow but at least allowing her to switch to her normal vision.

She looked down the length of her body and saw it then, a large scorpion-like creature, roughly half the size of a domestic cat. It was large by conventional Earth standards that is, though next to the giant insects in this chamber it was tiny. Its head was a mass of antennae and it had four crab-like claws, two small, two large. Its ten legs were segmented and moved cautiously, though now it crouched. It had not one, but three scorpion tails each larger than the rest, nested one within the other upon its back. It sat there, a dark mass over her left foot staring back at her with compound eyes. After what seemed an age, it started to move, hesitantly at first, its antennae tapping tentatively out a path for it to follow up Kara’s boot. It formed a regular pattern, tapping twice to left and right, tapping once in front, taking a step forward then tapping once again in front before repeating the whole cycle. Slowly it inched up her boot, her leg held fast by three sets of mandibles. It stepped delicately over the first , at her ankle, then moved on to the top of her boot.

As it reached the edge at the top of the red leather boot it stopped, delivering the first gentle tap to her flesh. It made her skin crawl. It then edged on over the second pair of mandibles locked around her leg just below her knee. The scorpion-thing stopped when it reached her knee, its antennae going into overdrive as it tapped lightly on her flesh in all directions. She closed her eyes tight shut, the sensation of impotence was maddening to her. She toyed with the idea of burning it off but she knew that would mean death for her, and at the moment all it had done was to tap her leg. But, almost as if they could read her mind, the creature that held her throat twisted its grip, the upper mandible pushing under her jaw, angling her head forcibly back, baring her throat and forcing her gaze up, up and away* from the creature crawling up her body.


She felt it moving over her knee and lower thigh, then over the third set of mandibles that held her leg across her upper thigh. She felt the delicate tap of its antennae and one of its ten legs slip beneath the ruffled hem of her red skirt. For a brief, terrible moment she thought it was going to crawl up there, between her thighs to her womanhood, but mercifully it retracted its segmented leg and instead placed it atop of the fabric of her skirt. The other legs followed suit, tapping delicately over her smooth bronzed thighs then onto the fabric of her skirt and then on until they had carried the creature to her hip. There it squatted, its full weight pressed down against her body. It stayed for a long moment and she realised as she felt its heart beat against her clothing and her flesh beneath, that it seemed to be syncopating itself with her own body’s beating pulse. The rhythm of its heart beat matched her own and only then did it continue. Patting out its tiny drum beat as it advanced up her body, over the flattened tautness of her abdomen and stomach. Her breathing was becoming faster with each passing second as the uncertainty in her grew, the fact that the creature was now out of sight from her tilted head just making things worse as her mind thought of all the terrible options it had. Would it plunge those terrible stingers deep into her proud heart? Was it destined to slit her bared throat with the razor sharp edge of those claws? Would it enter her mouth, perhaps to lay eggs or would the stingers be used to blind her? All of these awful dangers ran through her mind as the scorpion creature moved between her breasts, squatting again on the ‘S’ that was emblazoned over her chest, adjusting its position until the underside of its belly rested directly over her heart. The syncopation was even more obvious now, and when it was content it moved on, scuttling over to her collarbone, settling down on her chest. The antennae now played constantly before it, drumming lightly on her bare skin, tap – tap – tapping until it seemed to find what it wanted, then it slid its whole body forward an inch or so. As it sat over the little hollow where her neck met her torso it brought its claws into play, pinching the skin with the larger pair in two places whilst the smaller ones splayed the skin apart between them, smoothing the stretched skin out. She felt rather than saw something detach itself from the creature, landing on her neck with a disgustingly wet ‘schloop’ noise. She could feel from its contact with her skin that it was sinuous and approximately two inches long, of variable thickness. It seemed to secrete a slime trail of mucus like a slug as it started to edge its way up her body slowly following the curve of her neck around to the left side of her face.


“NNNNNGRRRRRRUUUHHHH!!!!” she growled in frustration at her own impotence as she realised with horror just where this creature was heading. She strained her limbs against the clamped jaws but to no effect. Sure enough, she felt it edge ever closer to its destination but knew she could do nothing to stop it. She rolled her eyes to the side where she could see a reflection of the firefly light illuminating her body in the black eyes of one of the creatures holding her down. She used her enhanced vision to zoom in on the tiny scene in that black reflection, seeing the little satellite creature heading slowly but surely towards her left ear. There seemed to be a thin strand, almost like an umbilical cord connecting it to the scorpion. She felt the sickening sensation as it slipped over the cusp of her ear and into its depths, her teeth gritted in a suppressed scream as she felt it slither into her, slipping slowly over the soft tiny hairs inside her ear, sticking them flat with its mucoidal trail, then massing up against her inner ear and the tympanic membrane. Held fast by the jaws at her throat, there was nothing she could do.


“MMMMnnnngggghhhuuuugggghhh!” she whined tearfully through clenched teeth at the disgusting sensation. When the slug creature was in place the scorpion seemed to come to life again rearing up and holding position for a second before stabbing down with the first of its tail spines. She felt the painful stab as it struck her – but it did not penetrate her skin. It tried again and again, provoking excited clicks and chattering from the surrounding host apart from the moth like creature whish still emitted the soothing purr. It wasn’t soothing her anymore, nor were the gentle strokes to her head and cheek. The scorpion creature squatted again before it then reared up, patted about her neck, then seemed to find a specific patch of her throat and this time squirted something on it. For an instant it felt cold but then it seemed to tingle and burn and she realised with horror that it had sprayed acid of some kind on her neck. She started to thrash violently, forcing more creatures to grip her body and pin her down.


“NO! NOOOOO!” she screamed before the mandible clamped around the back of her neck and just below her chin tightened painfully, stifling her cry. In the new grip she was finally able to dip her head slightly to catch a glimpse of the scorpion, but the view was both awkward and painful. She found she could see more in the reflected eyes of her captors. She switched her gaze back to the reflected image in those soulless eyes.


She saw the scorpion use its small claws to stretch the skin taut, then it stabbed down painfully with its second stinger. This pushed her skin inwards almost to breaking point but it held. The creature tried twice more and failed. Finally it reared up and squirted more of the painful acid on her throat. She could feel it burning her skin and tenderising it but it was not potent enough to eat its way through. But again the creature splayed the softened, now puckered skin taut before it reared up to its full height, its largest tail unfurled fully, quivering and then it plunged it down into Kara’s neck.
“AAAAAAUUUUUUUUUGGGGGGGGLLLLLLLHHHHHHH-- !!!!“ she let out a strangled scream before it was silenced.

This time the stinging spike pierced her skin and to her horror and revulsion she felt its tip enter her throat like a steel needle.




(*Sorry chaps couldn’t resist that one! :D )
Last edited by tallyho 13 years ago, edited 1 time in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

Our heroine is in great danger, eager to read more
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Great part T!

Loved SGs battle with the bugs and how they took her down. While things don't look good for SG I think Kara is about to learn things aren't what they seem. Great work dude!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
DrDominator9
Emissary
Emissary
Posts: 2486
Joined: 15 years ago
Location: On the Border of the Neutral Zone

Re: Supergirl and the Last Human

As always, TallyHo, an incredibly excellent work of intricate description, excellent plotting and spine-tingling peril. And the nuggets of humor are wonderful as well. Looking forward to more.
Follow this link to descriptions of my stories and easy links to them:

viewtopic.php?f=70&t=32025
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

Wow, thanks a lot guys, as always really appreciate the encouragment and feedback
sgz6 wrote:Great part T!

Loved SGs battle with the bugs and how they took her down. While things don't look good for SG I think Kara is about to learn things aren't what they seem. Great work dude!

You're shrewd cookie Sgz6! Hope I didn't make things too obvious.

Just doing a final edit so next part will be up in an hour or so.
Just wanted to say I have the aliens speak in this one , but I've tried to make it a bit different to standard pronunciation Queens English.(or even -ugh!- American English) ;)
It might look a bit odd particularly for non English speaking readers but the idea is you read it phonetically so it sounds like English , so 'of' is 'ov, 'not' is nodt etc. Not exactly, for all words but close enough that you can work them out. I hope it doesn't make understanding it too awkward but I wanted to give a sense of it sounding alien to Sg.

Probably fail miserably in the attempt but I wanted to try!
Thanks again everyone, readers and especially posters, next episode up shortly
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

PART 9

Supergirl’s eyes opened wide as her mouth gaped open in shock and pain as she felt the steel like point of the tail of the scorpion-creature pierce her throat. She gagged, the mandibles around her neck still present but much looser than before. She wondered if the poison would kill or paralyse her or even with her superior physicality whether it would have any effect at all on her Kryptonian constitution. She thought with horror of a slow death as this beast sprayed her with acid all over and then stabbed her again and again trying to have an effect, or maybe there were others either the same or of a different, more terrible kind, that would join it and she would be cut to pieces whilst still alive, their acid tenderising her skin before their razor sharp claws cut and peeled off strips of her flesh. Either way there was nothing she could do, except endure it, until the end came by whatever means. Her fate was no longer her own to decide.


A new, terrible sensation filled her as the tail spike withdrew momentarily and she felt the cold touch of the air in the chamber at the break in her skin, but only for an instant, before her own warm blood seeped into the tiny hole, then surged under pressure as the tail stabbed down again with a surgeon’s precision into the exact same wound at her neck. But then she felt something even more horrible. For this time the scorpion’s ‘sting’ stayed inside her, perhaps half a centimetre deep, then it started to shake and vibrate strangely. Then she suddenly felt it – a probing, sinuous point , a mere few hairs breadth in thickness, but slimey, and sharp as a needle, a thin worm like creature that slowly eked its way inside her throat as it emerged from within the point of the scorpions tail. A hideous living intruder that had violated her body, it’s very presence creating an awful, painful, stinging sensation deep inside her neck.


“AAUUUUUUUUGGGGGGGGGGGRRRRRLLLLLLLLLLLL!!!!” she screamed a strangled cry of horror, revulsion and despair, her eyes bulging and her tongue sticking out, as inside her she felt the creature penetrate her larynx, piercing her voice box and once inside it splayed out, the one strand becoming minute tendrils that she felt wrap around her vocal chords and tighten. Her back arched, her heels kicking against the floor as the creatures around her gripped her more tightly, holding her down as her body bucked and heaved in reflex reaction.


“AAAAAWWWWWWWWWWKKKK…no…” she gasped, feeling the tendrils vibrate, as she uttered what may be her last cry. She waited, thinking there might be other tentacles to emerge from the spine, that perhaps they were going to strangle her. But why? They had her helpless, they could kill her in a dozen different ways, so why on Earth, or on Krypton for that matter, would they choose this long painful and protracted means of ending her young life? Perhaps they were just cruel and sadistic creatures. Why should she have expected anything else from such merciless monsters that had annihilated mankind in the future and were now hunting its last survivors to extinction?


One of the ant-like two headed creatures loomed over her.


ZZZZBBBBBEKKK!” it chirped, with an accompanying waft of the noxious gas.


Her head swam as she inhaled the vapour. As it spoke she felt the creature inside her ear vibrate at the sound as it clicked and chirped.


“Awwwwwkkkk” she coughed, feeling the tendrils in her throat also vibrate at the sound she made. The scorpion creature seemed to emit a low noise and again a waft of the gas was released. Her heavy breathing was making her breasts rise and fall, bringing the bulk of the scorpion’s body into sight briefly, but only just. She thought she might just be able to burn it off with a concentrated powerful glance of her heat vision, before the mandible at her throat either snapped her neck or strangled the life out of her. But she would give it a try. She knew it would be her last act. She had to get the timing right; she needed to calm herself, to steel herself for this one last act of defiance. It would be a token gesture, but it might disrupt whatever their plans were for her.


ZZZZBBBBBEKKK!” the ant-creature clicked at her again and this time she was aware that the gas smell was the same as before. Not only that, but the vibration at her ear was the same. She frowned as she made the connection. The smells she could detect were actually pheromones! These insects communicated through smell, as did insect species on Earth! How could she have been so stupid? The sheer size and numbers of them meant that the pheromones they produced were infinitely more powerful than conventional Earth-based creatures and humans would produce, and that was why she found them nauseous and overpowering.


ZZZZBBBBBEKKK!” the ant-creature said, this time, as she was trying to distinguish any differences, there was absolutely no doubt it was with exactly the same scent and the same vibration as before. She was sure of it now – the creature attuning itself to her bodily rhythms and then attaching itself to her vocal chords, the symbiotic slug creature, vibrating against her inner ear to the sounds the ant – creature made – they were trying to communicate with her!


With tremendous effort she tried to speak. Her throat felt like she had crossed a desert for days, a terrible croaking dryness caused by the tentacles around her vocal chords. It felt like she was swallowing sand paper.


But she still didn’t know what 'ZZZZBBBBBEKKK!' meant.


“I……c-cccaaawwwwkkkkk-ah-ah …ca…c-can’t…underssssst…a……nn…d….” she croaked.


ZZZZBBBBBEKKK! ZZZZBBBBBEKKK!” the ant-creature screeched excitedly, moving both its heads in a figure of eight loop. “ZZZZBBBBBEKKK! UNNAZANNN!”


“I …c-ca…” she paused breathless from the effort. “I …c-can..can’t….un…derstand…you”


ZZZZBBBBBEKKK…..! UNNAZANNN! AARRUM -NA” the ant creature tapped at her throat and then her ear, then at its own mouth and an opening on its eyeless, smaller head that may or may not have been ear like indentations. When it said ‘UNNAZANNN’ there were the same smells and vibrations as those the scorpion had emitted when she had said ‘understand’. Then it lunged at her exposed throat with its jaws and almost closed them on her flesh but stopped. “AAARUM –NA” it clicked moving its head in a circle. It repeated the lunge and near bite then moved its head in a circle again, “AAARRUM –NA”. As it said this the jaws holding her down all slackened, though they still held her loosely.


Only then did she realise what it was saying: ‘Speak. Understand.’ Then possibly – from the gestures and context – ‘Harm no’, or ‘Harm not’? Maybe. It was a reasonable guess on her part. It was trying to speak English or rather the creatures attached to her were trying to mimic its clicks, chirps and smells into a kind of phonetic English.


“Y…y-ou want …m-me…to speak, to understand m-me….?” She croaked painfully, the scorpion emitting a series of vibrations, clicks and smells that sent the ant-like creature again circling its head in the looped figure eight that she realised was the equivalent of it nodding a ‘yes’. All the other creatures around her again repeated the motion, nodding their affirmation as it were.


UNNAZANNN! Un a zan…Un…a...da..zan! ZZZZBBBBBEKKK….ZZZBEEK…Unadazan! Zbeek…Unadazan. ” it chirped excitedly, the slug thing at her ear vibrating in tune with the clicked words, generating vibrations that she was able to resolve into some semblance of English, helping her understand them. She still found the pheromones difficult to cope with, however, but at least now she knew they were not trying to drug her deliberately.


She was surprised and bewildered, but at least talking with them might buy her time to recover. ‘Why on Earth did villains perpetually do this? Take time out to explain their plans before finishing the hero off thereby giving them time to actually escape’, she wondered. ‘Oh well, don’t look a gift horse in the mouth. Stall for time, recover, then maybe bust out of this hell-hole’. She decided to play along and to start with the basics, not least because she thought they were all she could utter. She painfully recited the alphabet to them, one slow letter at a time. It took her over fifteen minutes. She then spelled out ‘Speak’ and ‘understand’ for them. The creatures seemed to understand her intent, but they struggled with the phonetics, the ear-slug doing its best but ‘S’ sounds were ‘Z’s to them, ‘T’s were ‘D’s, ‘P’s were ‘B’s and that was how the vibrations at her ear came across. She tried at first to correct them but then realised they simply couldn’t grasp the difference. She pressed on and over the next hour or two they gradually learned to communicate, to a degree. She counted numbers out on her fingers and then repeated the count and pointed to ten creatures, one at a time, to teach them the basics of human numeracy. Her throat ached with the effort. As the words had slowly formed between her and the creatures and they gradually came to understand some of what each other said, so too the jaws holding her down eased their grip even further. They still held her very loosely, but when she tried to bring her arm up to her mouth to indicate she needed water or a drink, they did not resist the movement, but released that arm completely. She pointed into her mouth, then at her throat. “W-wa..water…” she croaked. “P-please, w-water.” She was a little annoyed with herself that she had used the superfluous word ‘please’ –politeness was something they would not understand and adding two words where only one was needed would not help them learn what she was saying. “W-water!” She dipped a finger into her mouth, gained the faintest speck of saliva and then showed it to her captors. “Water!”


Abok!” the ant-creature cried excitedly, a new waft of pheromones released by it and the rest of the host. A large round grub like creature came forward then, waddling slowly, reared up and to her horror tasted the finger with her saliva on it, made the alien nodding gesture and then it proceeded to projectile vomit straight into her face.


She gagged and gasped, blinking in shock and revulsion as she inevitably swallowed some of it, which was quickly replaced by surprise as it was both deliciously sweet as well as cool and refreshing. She realised it seemed to be an alien liquefied form of Royal Jelly, the honey-based nutritional jelly produced by and for queen bees. She fought down a wave of nausea – the creatures had tried to help her. The fact that she found the idea of it revolting was her fault not theirs. She wiped her face down with her free hand gasping but relieved. After that, she was able to speak more quickly and easily and gradually the vibrations in her ear became more attuned and less painful as she was able to understand at least some of what the creatures were saying. Though she still felt slightly nauseous at the thought of what had happened.


But the biggest surprise came with ‘Deracon!’. The ‘T’eHuRi –akha –n’ chirruping sound that she knew as ‘Deracon’ was translated by the ear creature into a series of vibrations that she could understand. It meant simply ‘Why do you kill us?


Kara felt shocked and confused. It was no battle cry after all but almost a plea for peace, a question to try and understand the incomprehensible, to make sense of slaughter. As the realisation hit her she felt sick to the pit of her stomach. She had killed hundreds, thousands of their kind when all they were trying to do was make themselves understood. Over the next hour as they conversed more freely she was able to glean more and more about them. Though their syntax was different in their sentence construction, and at times it was like talking to ‘Yoda’ she conceded to herself, it was getting easier to understand their intent with each word said.


“But… you tried to kill me…the beetle creature came at me with its jaws, it tried to bite me…” she said, fighting the rising sense of anguish at the terrible mistake she may have made.


Bite…no. Cadch. Handz, no. Carry all in jawz. Cadch all in jawz. Zway, Ztart Vall, cadch try. Thhh-en you end. Kill.


She realised then it was true. She had swooned at the strong pheromone smell and as she had teetered forward the beetle creature had sprung forward to try and catch her in its jaws. With no hands they, like Earth insects, had to use their jaws to pick up items and it had used its jaws to try and catch her as she fell. But she had misinterpreted the gesture as a lunging attack. And then she had gone on the offensive, killing and maiming thousands of them. She felt a surge of guilt overwhelm her. The acid, never sprayed at her, was simply them trying to stop the slaughter without hurting her by limiting her attacking options.


“You sent the insects to attack me…” she tailed off knowing now that was not the case, but still desperately hoping a ‘yes’ would ease her conscience.


Attack-no. Vetch. Bring dto uz…You dtoo vollo them…


So they were only to bring her here, to get her to follow them. It was no attack after all. “But…how did you control them?”


Umaz nodt only rrrrace ov mind walkerz” it chirped, the ear slug vibrating the sounds into a more recognizable form.


“Telepaths, we would say telepaths. You can read thoughts, control actions?” It nodded its figure eight nod for yes. “But why send hundreds of thousands.?”


Zendt one. Zendt dtwo. You zee nodt. Zend many. Dtoo many. Nodt eeezee control mindz.


As she swallowed back the tears of shame at her own actions, the lump that formed in her throat as she became upset was tremendously painful. She indicated the scorpion to the ant-like creature.


“Hurts” she said.


Urdtz?” It repeated. “Urdtz you. Endz them” she frowned and it read her look. “19 zpawningz hadched vor thiz. Join with you. Zbeek you. Hur you.” It brought its fore legs together, then pointed at its mouth, then pointed at its ear, then repeated. “Join you. Zbeek you. Hur you. They are ended.“


“You –you mean they will die, after this?” she said feeling more wretched than ever.


You are….’A’ Ro-th’ken’ to uz…in you zbeek, ‘ba’rrrba’rrrrianz’. They are ended, zo you unadazann”.


The scorpion and the slug creature were dying in doing this, but had apparently been specially bred for the purpose, if she had understood what was said, the culmination of 19 generations bred for this act. ‘A’Ro-th’ken’ - ‘Barbarians’- it seemed strange to think of herself and the humans in those terms but from the insects view, the term was apt. Man had done nothing but slaughter them. And so had she.


The ant-creature went on to describe the first encounters, how the future humans had used what the Deracon called ‘death –air’, their words for the chemical gas and toxins that they had fumigated the Deracon planets with. Man had attacked them, they had simply defended themselves. She realised the truth behind its words. These creatures had been massacred simply because they were different. She thought of mankind’s attitude now, in the 21st century. Just edging towards interplanetary exploration, with the first missions to Mars; to Venus. If they found an intelligent problem solving race that lived in cities, that grew crops, that domesticated other animals that had a societal hierarchy, that built bridges and tunnels and solved engineering problems with complex mathematical solutions on any of these worlds, they would be hailed as proof of intelligent alien life. Yet these societies existed right here on Earth and man simply poured boiling water on the ants nest or fumigated the wasps or bees. She thought of all she herself had done to harm and maim these creatures and she felt full of shame. Then there was the terrible war that would erupt in the future killing millions or even billions on both sides. She felt sickened.


“You have come to kill the All-Father, to end the future war?” she asked painfully.


The insects circled their heads in the negative gesture. “Badtdtle thev-vut” it clicked out and this was eventually buzzed and vibrated into her ear after several attempts. The phrase confused her for a second before she realised what they meant. It was saying ‘battle theft’, trying to emulate a human phrase.


“WAR CRIMES!” she said excitedly, “we would say he is wanted for war crimes.”


AURRR KRY –MZ” the creatures repeated back to her. They went on then to describe how this was the 42nd generation for some of the creatures on board this ship. They had lived and died here on board as they had travelled back and forth throughout time. They had had one mission – to avoid the future war with man all together. Slowly and with many mistakes the story gradually emerged. The insect race knew themselves as the ‘Ne-th’ which in their tongue meant simply ‘us’ and they had indeed intercepted the time drive details at what they called ‘the place of the Killing’, the battle that the All-Father had fled. Over the billions of years of their existence they had evolved beyond their natural state, absorbing first primitive then ever more complicated bits of their technology into their own bodies. They were actually bio mechanical hybrid creatures now, not pure bred insects, which explained some of their abilities, like the cloaking and the travel through space, utilising kinetic and static electricity to power their inbuilt devices. It seemed fantastic to her until she thought of the huge electricity charges that electric eels could generate here on Earth.


As best as Kara could figure out from the stilted conversations, they had been around some 2 billion years before Man. With much shorter generation spans and massive egg numbers laid, they had evolved and diversified quickly, far outstripping mankind but at a much simpler, more natural level of technology. A distant branch of their race had originally colonised Earth, but the stronger Earth gravity than the ones the creatures were used to had caused them to evolve ever smaller under what was to them the crushing weight of the Earth’s atmosphere, eventually becoming pure carbon based rather than silica creatures. Contact with them and the rest of the Deracon had been lost hundreds of millions of years ago. So the Deracon had been oblivious to humans until Meiros was attacked. When the paths of the two races had finally crossed it had been disastrous for them initially, before their devastating counter attack. It had been decided then after their victory that they would build a time drive of their own and travel back to avoid the war all together, by making a peaceful first meeting with humans. It had taken them over 1900 human years to build it, as they had to breed creatures with specific bio-mechanical properties, hundreds of generations, each generation adding a little more to the whole, taking them a step nearer, which explained why this huge creature ship was so different to the smaller vessels that the media orb portrayed. But they were able to produce batches of millions of creatures in tandem, and then interbreed the results so the ‘research’ as it were could run in a thousand different threads simultaneously, then interbreed the output and so on. Eventually they had succeeded.

They would stop the conflict ever arising in the first place. But all attempts at friendly contact had failed. They had tried to make contact throughout human history, trying to find a time when they might be accepted. This current situation was purely a slight variation on the mission for them, that when they had worked out when the All-Father had fled to, time wise, they had decided to try and capture him, again to help avoid a future conflict all together by stopping whatever his current plans were.

The ant-creature made a despairing sigh-like sound. All of their attempts at a friendly relationship had so far failed. Curious, Kara pressed them further as to what they meant in detail.


The ant-creature indicated a large olive-green coloured beetle, which had thick chitin plates nested like scales over its body, four ridiculously spindly legs, large green membrane-covered wings folded across its back and a thin neck stem. Its head was diamond shaped with three sets of layered jaws each recessed from the last, so the first inner jaw was most prominent, the outer jaw containing just two teeth was tight to where an animal would have had its cheek. It was the opposite of the alien’s jaw in ‘Predator’. From the side it looked like a ferocious, snout –like mouth, bristling in teeth and somehow strangely familiar to her. It was about the size of a large rhinoceros, but seemed timid, almost embarrassed at the attention. It seemed a shy , gentle creature despite its size, like an elephant. It had two short antennae at the top, above and behind the bulk of its head. They looked a little like horns.


This sub species were known as the ‘T-uh-Ra-ko’, one of the most intelligent of the Ne-th. The ant- creature explained that a team of some fifty of them had been dispatched centuries ago, with delegates travelling in ones and twos throughout the world in a bid to make contact. But man had been frightened by their appearance and had hunted them down and destroyed them all, except a few who returned and remained on board this creature ship.


Kara was confused at first, but then the penny dropped as the creature turned side on to her, revealing a segmented straight tail with a sharp, triangular point at the tip. It looked a little like-


“A DRAGON!“ She cried, wincing in pain, briefly. “They thought you were dragons. ‘T-uh-Ra-ko’ to a human ear would be ‘DRAGO or DRAKO’ . They thought you were monsters.”


Ended all.” The ant-creature stated. “Knew zcare. ‘T-uh-Ra-ko’ hundt –“ he gestured and the creature spat out a bright yellow luminous jet of acid that glowed like flame, to indicate how they hunted their prey. “Vear cauze vor barbarianz. Ended all ‘T-uh-Ra-ko’. Nexdt dtry the ‘Qo-hu-Bl –i-nth’ “ he indicated a smaller almost man sized creature which dutifully reared up on its hind legs, some 4-5 feet in height, its middle pair of legs retracting into its torso. Its front pair of legs hung limply down like arms. It did look less frightening and more human, no question. It had large ovoid eyes on a lozenge shaped upright head that was pale green on a short fat neck stem and two small vestigial wings at the side of its head that looked like –pointy ears!


Dtry drezzz az barbarianzzz. Zdill Vear. Zdill end all. Think vvvvvariezzzzz.


“Faeries! They thought you were faeries and -‘Qo-hu-Bl –i-nth’ -goblins!” She wondered just how many more folk tales and legends around the world were down to these creatures’ attempts to make contact. She also wondered just how many of them had sacrificed themselves in that cause.


NexdT dtry dteeech lang-oo ge. No more meedt” It went on to describe how they had decided to stop contact and meeting man and had written the elements of their language down, stealing the paper , quills and ink from monasteries, describing how man could cross pollinate species to create flowers with aromas similar to the pheromones, essentially creating a scent alphabet. They had also annotated star maps and cultural references. They had even tried to put their language down in the written form as they could not write or understand English. They had told how they hoped to live in peace and avoid conflict. They had left copies of this manuscript in the thirteenth, fourteenth and fifteenth centuries of Earth, hoping that men of science would be able to understand the language over time and therefore aid future acceptance of them when they made contact.


“THE VOYNICH MANUSCRIPT! That was you!” She cried forgetting the creature in her throat and then wincing painfully. She was referring to the strange medieval document that had a whole host of odd drawings of plants that were similar to some species but that didn’t actually exist on Earth. It was written in a bizarre language that no one had ever been able to translate or decipher. It was assumed to be some kind of code. The alien looked confused and she added “Not important –name of only copy that survived.” She found herself speaking in a stilted fashion so that they could understand her better. She understood now – they’re intent was genuinely peaceful. But she was curious about one part of the Manuscript.


“But the Manuscript is full of paintings of naked women bathing…why?” she asked.


The creatures chirped and chattered in what may have been laughter. “Make …male…zciendizdz zdudy…”


She almost laughed herself. They had obviously understood mankind very well. How better to make the medieval scientists want to study the documents than by filling them with pictures of naked women out of context? It was, she conceded very clever of them. They had made a medieval ‘Playboy’.


The ant-creature finally asked her a question. “Whadt…name?


Kara told them but it seemed to cause confusion. “Name ov you…iz nothing…d-tellz nothing. AM –“ it gestured to indicate itself “- 89-487-6900017-378-44. D-Tellz plan-edt, colony, had-ching number, badch number, zeazon ov had-ching. ZubergRRrl…meanz nothing.”


The way she felt right now, she felt like she meant nothing too. ”It’s a name that means I try to help people…” she said with a heavy sigh.


Why…help…you…them?” the ant creature asked her. “Vuchur…umaz?”


Good question. Why was she helping the future humans? She sighed again “Because…because sometimes I am not as smart as I like to think I am…” she said heavily, more to herself than those around her. “Don’t worry. “ She said with resolve. ”I’m not helping them anymore. You want their leader? Well so do I. Let’s go get him.” She said grimly with a steely look in her eye.


The creature at her throat responded to a command from the ant-creature, withdrawing first the tendrils around her vocal chords then the stinger itself. She felt it squirt another jet of liquid onto her throat and thought to her horror they had tricked her somehow and that it was another acid attack. But in an instant she could feel it acting as a soothing balm on her scarred and puckered skin. She could feel the minor wound healing instantly and the slug creature dropped out of her ear, dead.


The scorpion fell off her chest too, landing on its back, legs curled in the air. It gave a last quiet click of its jaws and a weak burst of faint pheromones and then lay still. Kara sat upright, bracing her upper body on her palms for a moment as she took a breath. The air was still foul and rank to her, but at least she knew now it wasn’t poison. She looked down at the curled body of the scorpion lying beside her. Hard to believe it had terrified her just a few hours ago, yet now she felt pity for it. Its whole raison d’etre had been to communicate between the two races and it had given its life for that purpose. She would make sure that it hadn’t died in vain. And she knew just where to start.
But first she needed to see someone.




Kara landed lightly on her feet at the back of Rob’s shop and breezed around the corner to the front as Linda. She just wanted to stop by and assure Rob she was o.k. To her surprise, Em was still there. Rob was giving her the dubious benefit of his singing talents with an off key serenade.


It’s funny how the girls you fall in love with never fancy you,
It’s funny how the ones you don’t do.
It’s funny how the pretty girls don’t take the time to talk to me,
Just walk away what –ever I dooooo!

Don’t pass me up again!
‘Cos I’m not that tough.
Haven’t you seen
Me suffer enough
?”


He was twirling and wagging a finger at a rather bewildered Em, who seemed to know all about suffering, when he saw her come through the door and froze. He went white, as the colour drained from his face.


“OH!” he said with a mix of relief and perhaps ..fear? His reaction threw her completely. She looked quizzically at him and then frowned at Em before raising an eyebrow, inviting an explanation.


“I’m glad you are ok…and…come back safe.” He was nervously wiping his hands on his tea towel. He looked scared, there was no doubt about it. He followed her gaze to Em “Oh, er…her hippy mates turned up…there was a bit of a hoo-haa. Erm, she’s kinda staying here now…” he was struggling to look her in the eye.


“Ooo, Rob, you old dog!” she teased him gently, to which he went bright red.


Em embraced her tearfully. “I am cast out! Forsaken by the All-Father! What will I do?” she said in a whisper.


Kara consoled her, holding her reassuringly by the shoulders as she looked intently into Em’s big, brown, tearful eyes. “It’s ok. Just stay here for now, ok? We’ll figure something out. Trust me, you don’t wanna be anywhere near the All-Father. Stay here for now , ok? Rob will look after you, alright?” she said in Chengduish.
“Look after her Rob, I gotta be somewhere…” she said to the café owner as she half turned away.


“What you done to your neck? Been bit by something, looks nasty…” he pointed to the red patch of puckered skin at her throat.


“It’s nothing Rob. I gotta go just popped by to say I’m ok”


“WAIT!” He cried urgently, so much so it startled her a little. “We…we need to talk…” he gestured her over to the far end of the counter, beckoning her with his hand.


“What gives?” she said genuinely curious. “Can’t it wait? I really gotta go…”


“I…I had that bit of a run in, the other day, with those guys, before the insects came, remember?” He said nervously.


“Sure.” She had no idea where he was going with this.


“Well, after the shop got trashed and the windows broken I called in a firm to secure up the shop for the night…”


“So…?”


“So…they said I probably needed a bit of extra security out back…you know…like a web cam…” he was polishing a mythical blemish on the counter again and avoiding her gaze.


Now it was her turn to go white. She didn’t say anything.


“Thing is when I saw the footage from this morning, you walk out the back…and then…th-then Superlady is there…” he tailed off. “And there was the hot tea on your hand…and when the insects came you ran off and then Superlady came…” he couldn’t look her in the eye.


She didn’t know what to say. Occasionally she had had to reveal her identity before but never had someone accidentally discovered it.


He placed a tiny memory stick on the counter just a centimetre or so big plus the connecting point.


“Thing is…times are tough all over…something like that…well, worth a LOT of wonga…”


“Wonga?”


“Oh, er dosh, cash, you know, money, like. A lot of money. Gotta figure newspapers or the telly would pay millions for a scoop like that.”


She started to feel sick in the pit of her stomach as he went on.


“These are tough times all over, for everyone. Chunk of money like that …well, can change people’s lives forever. Make good guys do bad things… you know what I’m saying? Superlady needs to be careful. Needs to make sure stuff like that don’t get out. I’m sure something like pictures of her true identity would be worth a fortune to criminals and stuff too. Like, take this place… I’m on the bones of me arse running this caff. Take home about $80 bucks a week only ‘cos I don’t draw a wage. I’m way in the red. Chunk of money like that …well its life changing…People would do anything, even people Superlady might trust… She needs to be careful stuff like that don’t get out.” He slid the tiny flash drive over to her. She stared at it in shock and then looked at him with hatred and revulsion.


Kara swallowed back the tears, and this time the pain in her throat had nothing to do with the Scorpion creature. She couldn’t believe her friend was blackmailing her.


“Its ‘GIRL’ Rob.” She hissed at him through clenched teeth. I’m SuperGIRL. And you don’t wanna mess with me.”she spat the words out angrily. “I’m goin’ to Starbucks…it stinks in here…” she said bitterly as she turned on her heel and left. She had no idea what she was going to do about the situation. Now, of all times, she didn’t need this.


“Aw, Harvey , have you let one rip again you dirty bugger?” Rob chastised the dog. Kara spun back to face him, marching angrily back to the counter and staring at him face to face.


“It ain’t Harvey that stinks Rob, it’s YOU. You’re just a…a fat, dumb asshole.” She hissed loudly again through clenched teeth and with tears in her eyes, before she turned and headed for the door.


He swallowed hard looking deeply offended, smoothing his flattened palms over his apron as he looked down awkwardly at his overweight body.

“Eh? I know…” he said in a small voice –“I-I’ll use more deodorant then, sorry…Hey wait!” he snatched up the drive off the counter and ran after her as fast as his bulk would allow. “You forgot this!” he hissed after her in a loud whisper.


He caught up with her outside and grabbed her elbow to pull her back, but Kara forgot herself and just kept walking, yanking him forward off balance so he fell in a heap on the path behind her. She turned as she heard him fall, with a certain sense of guilty pleasure that she had hurt him. He sat there holding his knee and ‘TTTTHHHHHHHHHUH’ –ing. He looked like Peter Griffin in ‘Family Guy’.


“Hey! SUPER - huh-ERB ass you got love!” he managed to cover himself as she turned away again contemptuously. “WAIT, girl, you forgot THESE!” he held up the flash drive towards her. “The pictures” He whispered loudly. “And you’ll need to come round and wipe the laptop too.” He hissed in a more normal whisper. “I think I deleted them but the last thing we want is some scrote breaking in and stealing it and accidentally finding it tucked away somewhere. I assume you are good at that sort of stuff? I’m crap. But here you forgot this!” He held up the drive again. “You can pop round after and get rid of them off the lap top.” He looked desperate for her to take it.


“Get OUT OF MY SIGHT!” she shouted angrily.


He looked at her confused and slightly frightened as he held up the tiny flash drive. “B-but you forgot this…here.” He offered it to her again.


“Wait…your giving these to me?” she asked slightly confused.


“Well…’ course I am. Haven’t you been listening? I been saying you need to be more careful, you need to look after shit like this. It won’t always be blokes like me who see it, and these days there are more and more cameras everywhere, you need to be careful. People are desperate since the global recession.” he whispered. “Superlady needs to be more careful…Oh, er, girl I mean.”


“Well…why are you giving this to me, why didn’t you just wipe it and say nothing?” She asked.


“I thought you might wanna see what it looked like when you changed, you know work out the camera angles or blind spots and then you can change behind the shop whenever you want but it won’t be recorded. Don’t cry, love, no-one has seen it ‘cept me.”


“Awww, Rob.” She sighed. “I’m so sorry…I thought…I’m not having a good day today…”


“You thought what ?” he asked innocently. “I know you only said them things about me to preserve your undercover identity as…” he paused desperately trying to remember her name “…as…Jane?” he said hesitantly. “You know, so no one would know I was your, mate like…”


She smiled. “Never mind what I thought Rob, I was just being a jerk. I’m sorry.” She helped him up.


“I fell over!” he said sounding like a little boy as he rubbed his knee.


“I know Rob, I saw.” She smiled at him gently, then hugged him and kissed his cheek lightly. “I’m sorry I doubted you.”


“I’m sorry the shop is smelly. Or I am. I’ll get some more deodorant and air fresheners or something” he said as he limped back to the doorway. She watched him go and smiled. She should have had more faith in her friend.


“Is the lap top all switched on now? I can pop in and clear it now if you like.” She asked.


“Oh…er….it is on, but later is fine…” he stammered awkwardly.


“No time like the present.” She trotted quickly passed him into the back of the shop

“No-NO ! Its ok! Later be - bes…t” he called but she had already gone into the office. He sighed and rolled his eyes. “Oh Gods of Porn, do not forsake me!” he whispered as he looked up at the ceiling.


She emerged a few minutes later.


“All done.” She smiled and handed back the flash drive. “I’ve wiped that too.”


“Did you…find anything else….?” He asked hesitantly, relieved when she shook her head.


“Nope. One thing though… I thought you were a dog lover? Thought you didn’t like cats?” she asked innocently as she squatted and patted Harvey, stroking his upturned belly and eliciting a satisfied moan. Rob was sitting on a stool with his trouser leg rolled up whilst Em was dabbing iodine on his skinned knee.


Rob seemed confused. “Well, of course I am. You never hear of a cat dragging anyone out of a burning house or raising the alarm when burglars break in. Dogs bring you the newspaper or your slippers, cats bring you a dead bird or a mouse. Dogs have masters, cats have servants. I bloody hate cats.”


“Yeah that’s what I thought. So you can imagine my surprise when I found a folder on your drive called ‘Pussy Pics’…” she raised a questioning eyebrow as she hid a smile, with a look in her eye of pure devilment.


Rob went the colour of the Japanese flag. “ER….I-I…err…it’s…it’s…er…”


She leaned forward and whispered in his ear. “It’s ok, I didn’t look.” She kissed him again lightly on the cheek. “We’ll just both pretend it was cute cat pictures from the internet. ‘Can I haz Cheezburger?’ stuff, ok?” she smiled. “Some mysteries are better left unsolved. Now we both know each other’s secrets.”


He let out a relieved sigh. “C’mon. Let’s have a drink on it.” He reached for two cups.


“Can’t Rob, gotta be somewhere.” She shook her head.


“Where’re you going now?” he asked her.


Guess I’m headin’ on up to Kansas, to put things right.” She whispered quietly to herself. “Just somewhere, Rob. You look after Em, until I get back, ok?”


“You may wanna go out the back….(camera’s off)” he added the last in a whisper and smiled.


She smiled gently back at him and nodded reassuringly to Em, then stepped out through the back of the shop and cast a speedy eye around the neighbouring buildings. Rob was absolutely right. She needed to be more careful, as there were cameras everywhere these days. In an instant Supergirl was ready to take off. She cast a lingering glance back in through the walls of the café. Just ordinary people, doing ordinary things. And Em of course. She smiled as Rob fell over a sprawled Harvey and hurt his other knee, cursing loudly. She felt guilty that she had doubted him. She felt guilty too about what she had done to the Ne’th. Well, now she knew the truth. She knew who to blame and she knew who her real enemy was. It wasn’t the so called Deracon and it certainly wasn’t her true friends.


It was a group of humans who hadn’t even been born yet. Well, she was gonna make them wish that they never were.





“WHAT DO YOU MEAN SHE HAS GONE!!!!!!” railed the All-Father. “GONE WHERE?!!! AND HOW COULD SHE TURN AGAINST US? HOW COULD SHE FIND OUT?!!!!”


Jaeger looked nervous. The All-Fathers rages were notorious. “She spoke with the Breeder… then set off for the Deracon ship. We could see nothing but it is vast, she said, some many miles long. There must be thousands aboard…I scanned the Breeder, she inadvertently gave clues to the Angel. I could sense her turn against us…”


“You did not return with the Breeder? Then I trust she is terminated.”


“Er,… no All-Father, there were authorities present, it would have been difficult…”


“She LIVES?!!! DAMN YOU AND YOUR GENES JAEGER! You were sent to CONTROL THE SITUATION!!!”


“We have already made contingencies should she turn against us. The two warriors we dispatched a few days ago have been …partially successful…”


“’PARTIALLY?!!!’PARTIALLLY’?!!!WHAT NOW?!!! HOW SO, ‘PARTIALLY’?!!” the patriarch shouted.


“One was killed entering the facility, but the other was successful. He has destroyed the fallen warrior’s body and has returned. The government here will not learn of the thought devices.”


“FINALLY! SOMEONE WHO IS COMPETENT.” The All-Father shouted, then took some deep breaths and calmed himself. “We have Timon’s device. We now have the ore. You identified a source of leverage over her?” Jaeger nodded. “Then I suggest you go and get him.”

“I have already sent Galen , Sire.” Jaeger responded to the leverage issue. “He will return shortly.”

“If the Deracon ship is as big as she said, they may well overpower her, but even then we would need to find her body. But she is the Angel! I’m sure she will triumph! We still have the means to control her to our will. We just need to find her. Where is the Reacher? REACHER!!!” the All-Father called out.


“REACHER!!!” the All-Father shouted once more.


“I am here, Sire.” The Reacher answered, stepping through the open doorway, into the mansion study that served as the All-Father’s private office. “The others are concerned at this news, Sire…”
‘And so am I….’ he thought to himself.


“DAMN THEIR GENETICS! THEY ARE OF NO IMPORTANCE!!! THE ANGEL , REACHER, THE ANGEL. WE MUST FIND HER! USE YOUR GIFTS, HUNT HER DOWN. WE WILL FIND HER AND TAKE WHAT SHE WILL NOT GIVE!”


“No need, Sire. I have already found her. She is on her way here… Was on her way here… Is here. She landed in the grounds but a moment ago. And…” he rolled his eyes to the ceiling as he made a brief mental contact before looking back at the All-Father “I think, to use the parlance of this age……she’s pretty pissed at you.” The Reacher said.
Attachments
voynich1.jpg
The Voynich manuscript plants
voynich1.jpg (10.01 KiB) Viewed 21879 times
_68289504_voynich_1006113_quarter.jpg
more oddities
_68289504_voynich_1006113_quarter.jpg (11.53 KiB) Viewed 21879 times
_68289505_voynich_manuscrito151.jpg
the naked ladies
_68289505_voynich_manuscrito151.jpg (22.04 KiB) Viewed 21879 times
Last edited by tallyho 7 years ago, edited 1 time in total.
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

I did not expect that the story would change this, but it was very good
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

T you did a great job conveying how bad Supergirl felt as she learned the truth. Good job showing feelings and how off kilter it made her. Like getting mad at Rob when he was trying to do the right thing. Love the last bit though, "She's pissed." :)

Looking forward to Supergirl putting things right!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
User avatar
DrDominator9
Emissary
Emissary
Posts: 2486
Joined: 15 years ago
Location: On the Border of the Neutral Zone

Re: Supergirl and the Last Human

Very interesting chapter, Tallyho. You never fail to deliver insightful and thought-provoking stories. SG may be pissed at the All-Father but I have a feeling he's got a trick or two up his sleeve to make SG more than uncomfortable before this tale comes to an end. I look forward to it very much.
Follow this link to descriptions of my stories and easy links to them:

viewtopic.php?f=70&t=32025
User avatar
tallyho
Ambassador
Ambassador
Posts: 5424
Joined: 15 years ago
Location: Land of No Hope and Past Glories

Re: Supergirl and the Last Human

PART 10

Kara landed lightly on her feet on the lawn of the extensive rear gardens of the mansion. She had clearly startled one of the young warriors on patrol in the grounds who looked at her wide eyed and then bowed with reverence as he backed away. Two of the scientists and one of the builder caste, an engineer in effect, were grouped around an ornamental sundial some thirty feet away. They saw her and waved, but she ignored them. She took a deep breath and consciously slowed her breathing, calming herself down. No good ever came of acting in anger. She scanned the house with her x-ray vision, locating the other group members inside, in the various rooms. But she wasn’t looking for people.

She had already made one disastrous mistake today by believing what she had been told; she didn’t intend to make the same mistake again. She had had her suspicions of the time travellers since the start and those doubts had been confirmed by Em and the stories of the re-education camps and the terrible fate that befell the children who did not measure up to idealised standards of perfection. She had thought they were fascists almost right from the start; the militaristic society; the powerful, quasi-religious figure head; the blind obedience to the state; the terrible suppression of those who opposed it. All the signs had been there. But she had felt that the alien race annihilating mankind was still a primary threat, that perhaps by her very interaction with these refugees and her supposedly god-like status within the group, she might be able to influence them to change for the better. So she had suppressed her doubts, turned a blind eye to the obvious. The All-Father - the Fuhrer; racial purity; suppression of the weak; elimination of those who resisted; camps or in this case entire planets dedicated to extinction of the enemies of the state. The Eugenics Wars. The very name screamed those same echoing thoughts of gas chambers and mass murder. The warped motto of 'Pax Per Nex' - 'peace through murder'. But she had chosen not to listen, to believe that maybe things weren’t as she feared they might be. That the future of the human race would still have a vestige of humanity left in it. Apparently, she was wrong.

Well now, that future ended here, this day. But to stop it she needed to see the Journal, to confirm her fears, to justify her actions but above all to find out the best way to stop it without changing elements of the immediate destiny of Man. After all, she was a ‘Lee’; and ‘Lees’ were ‘not heedless of the future’. She smiled grimly to herself, breathing heavily through her flaring nostrils.

She was struggling to find the book through the walls of the house. Too much clutter was building up as she looked deeper into the building. She could at least see where it wasn’t. She took to the air circling the property, much to the confusion of those who saw her. She could spot the All-Father and his flowing robes moving about downstairs with a gaggle of his cronies. Though she hadn’t felt anything, she had no doubt the telepaths had read her thoughts, and so knew her intent. Probably they were trying to hide it from her even as she stood or rather floated, searching for it. In fact only one of them had read her, and he no longer gave a damn. She didn’t scan the small outdoor pool changing rooms that were some distance from the main building, so she didn’t spot the two Workers and the person they were guarding.

She finally located the Journal under lock and key, in the safe of the master bedroom, together with the All-Father’s personal media orb which she also took. It was a strong safe but in a moment the book was in her hands and a moment after that she had finished it. She had flown back outside, some 60 feet above the roof to read it undisturbed, whilst she thought about her actions. Flicking the ancient paper that, bizarrely, had not yet been made, she skimmed through it in seconds. And whilst this was largely the musings of a child, the signs were there as the journal progressed and the child grew older. The seeds of fascism were planted. The warped conclusions of the child as he reached his teenage years and the bizarre fixation with herself, and the depictions and descriptions of her exploits, were almost a surreal experience for her as she read of things she had not even done yet. It was all there to be passed like a poison into the mind of his son, the Second Father, the founder of the Order and the architect of a terrible future for the human race that would last centuries. And all this, the dreadful years of suffering, because in a few short weeks from now she would save the life of a small child. She still had no idea what she was going to do about that. It was all very well to decide if you were going to save or let die a tyrant, whose actions had directly destroyed millions, like Hitler. But what to do when it was not the tyrant, but the tyrant’s father? Do you judge him for the deeds of his son? Or even what his son might become? It was a quick way to get a headache, just thinking about such details. But what if that was your ONLY chance to stop it? Dare you blame someone for another’s actions? Or future actions, deeds not yet done? Could you take a chance and let them live when billions of lives were ultimately resting on that decision? Just holding the book, with the knowledge of what it represented or would come to represent, a warped manual for oppression, sickened her.

In a fit of anger she hurled the book into the air, incinerating it to a shower of ashes with her gaze, but its contents already committed to her memory. She turned her attention to the media orb. This, as the All-Father’s personal orb, had no security restrictions on what could be viewed and he had complete access to all Empire records. She simply had to access it to know all she needed. After a few attempts she managed to get the orb working, though as it was sync-ed to the All-Father’s own thought patterns it did not play as it should, the images and sounds speeded up beyond human ability to see and hear the projected 3D image. But with her superior abilities she was able to follow it easily enough, and as it brought up hazy links to her own thoughts – Talomere, the Eugenics Wars, the purges against those who resisted -so it grew to respond more accurately to what she was thinking. More horrors were revealed – the appalling treatment of the slave race, the Quelg, the detailed destruction of the Deracon colonies, the mind wiping process that lobotomised those who dared speak out against the regime. The mass executions carried out with particular relish by the so-called ‘Butcher of Talomere’, a warrior known as Bar Hau-Chai. Children. The Old. The Young. Men. Women. All murdered in the name of the State. His methods had been so excessive that Bar Hau-Chai had been demoted quietly from his once powerful position as one of the leaders of the Warrior Caste to a minor post, subservient even to Galen. She dreaded to think what atrocity might have overstepped the mark for a people with no morals and fewer scruples. Despite herself, the thought crossed her mind and an instant later the orb read them and she saw the answer. He had gone berserk, mad with power, slaughtering a group of children before they had even been assessed to see if they were worthy Empire citizens. Yet he had not been executed, merely quietly demoted, in case such butchery were ever to be needed again in the service of the Empire. She fought back the tears that pricked at the corners of her eyes and composed herself. Finally she thought of the plague, Lehrmann’s Disease. How ironic that the thoughts of racial purity and white supremacy planted into the mind of the Second Father should be warped, changed by nature in that mostly Asians survived the outbreak and preserving the purity of the strongest bloodlines resulted in a world where most of the populace were non-white. Even at the time of the last battle at the God’s Eye Nebula, some 6 or 7 centuries after it had first appeared, the disease had still not been eradicated. There was still no cure and with it lying dormant for decades with no symptoms until it would flare up, it was impossible to impose completely effective quarantines. It seemed the illness would lie dormant in as little as one single human cell until activated and then would spread throughout the host in hours. A few who fought it off successfully would become carriers, and in some cases the illness passed from generation to generation, the only evidence a tiny circular pattern of irregular bruising on the underside of their forearm. But these bruises were intermittent and sometimes did not appear at all. Once every thirty to forty years there would be an outbreak of variable severity. The last one some forty years previously to the battle had been the Valtan Outbreak, which had killed some 450,000. The virus would not appear in her lifetime until the mid-2050’s, its origins unknown. She had the next four decades to worry about that and to try and stop it. She absorbed all the medical data on the disease she could from the orb, then when satisfied she had seen enough, she destroyed it, crushing it in her hands to a lump of useless metal and circuitry.
She thought about what she had learned of her own future actions. Oddly the First Father was never actually named in the Journal, just referred to in the second person, called ‘he’ or else ’Father’ , and even in the media orb they only referred to him by the title. Even references to the Second Father, the writer of the Sacred Journal, were vague on the orb, naming him only as Richard. She realised to her surprise that the names had been lost over the centuries, supplanted by the titles. She was frustrated as it made her job of tracing the First Father in this time harder. Yet next month she would save him, as a small boy, on the 21st to be exact. That was virtually the only fact that she knew about the rescue; the rest was in such ridiculously flowery language, the exaggerations of a child, that it told her almost nothing. Other than it would be here in Metro City, that she would fly and use her ‘command of the wind’ which she took to be her breath, to save him. Even the threat was only vaguely described as simply a ‘terrible danger’. She dismissed such thoughts. She needed to concentrate on the here and now. She looked down at the crumpled metal orb in her hand, deep in thought, then set her mind to her task.
Tossing the orb aside, she quickly located the All-Father near the rear of the building, in a large room that was part games room, part gymnasium, with one wall opening up into a large indoor swimming pool. There were mostly exercise mats on the floor, with a rowing machine, a few exercise bikes and a cross trainer spread out amongst the mats. The walls bore a few expensive water-colours, a dartboard, some pinball machines and a pool table, whilst in the swimming pool room a large antique clock and an even larger antique wall thermometer were the only trappings of decadence.

She burst through the patio doors in a shower of reinforced glass, wood and pvc.

“Knock-Knock.” She said with venom. Rob would’ve recognised that entrance as John Wayne from ‘Brannigan’, she thought idly then dismissed such trivialities from her mind. She had a job to do. The warrior Galen stepped forward nervously between her and the All-Father, then read her intent and hesitated. The Reacher and Jaeger were present too, as was the scientist Tjulias. There was another young warrior that she recognised and an engineer, together with a very large man standing half in shadow that she hadn’t seen before. From his bulk and his rather cruel expression she marked him down as a warrior too. He was the only one who didn’t look startled. He was at her three o’clock and as he stepped towards her fully into the light she realised she did know him, but only from the media orb. He had a waxy paleness to his skin that spoke of Polynesian or even Phillipino ancestry rather than the usual Chinese-Asian, with mean, sharp eyes and a cruel slit for a mouth. It was Bar Hau –Chai. He had been the only Warrior to return from the special mission.


“This? THIS? “ he gestured with his palms towards her. “THIS is the Angel?” he laughed. “This is whom you feared angering? She is nothing” he leered at her with a cruel smile. “You dare to turn against us? You refuse us your genetics? We will take your DNA. Then I WILL TAKE YOU.”


“Bar Hau-Chai , you do not understand, she is-“ Jaeger began.


“What do I need to understand? She is nothing. A child.” He cut the telepath off.


“She has immense powers, she can-“ Jaeger tried again.


“She is NOTHING! A little girl. I HAVE KILLED THOUSANDS, CHILD.” He stepped in closer towards her, bearing down on her menacingly. “And if I have to, I will kill you. But I do so like to make the young ones suffer.” He smiled malevolently.


Supergirl hadn’t moved but stood, fingers on her hips, staring at the All-Father. Her bright blue eyes were dulled for once. Her thoughts seemed to be far away as she listened impassively as the warrior spoke. In her mind’s eye she could see the images from the orb, the horrific loss of life at Talomere. All perpetuated and in some cases instigated both directly and indirectly for years by this man who stood side on to her, at her 3 o’clock. She felt almost that there was no decision to make and that saddened her deep down, as she had always believed all life to be precious. Yet today she killed and maimed over 1400 intelligent beings who had only been trying to communicate with her. She would have to come to terms with her actions and it would be difficult and painful for her to live with that guilt. Worst of all was the memory of what the Ne’th had said on the matter - ‘Vorg –Ven’. Their version of ‘forgiven’. She didn’t want to be forgiven, she wanted…to turn back the clock. But she knew such thoughts were dangerous – dabbling in time travel full stop was dangerously seductive. Once you made one change, where would it end? Taking all those innocent lives was a terrible tragedy. But she would try to find a way to live with it. But what she was about to do now, to this…this scum of humanity? She knew she could live with. No problem at all. She let out a long, slow, weary sigh, resigned to her task. She was resolute now, coldly compassionless.


Bar Hau-Chai was still droning on –“I alone took the first gate at the Siege of Nidum Vale! I have made a thousand widows in hand to hand combat, more even, and now, little girl, you would dare to stand before me, to go against the will of the All-Father? I’m going to-“


No one would ever know what Bar Hau-Chai was going to do, least of all Bar Hau-Chai himself. Her right arm flashed up as he stepped within arms-length of her. The rest of her body was totally still and she never took her eyes from the All-Father, her head perfectly still. Bar Hau-Chai caught the briefest glimpse of her hand movement at the last moment. He was a trained fighter and had lightning fast reactions himself, but he was no match for her super speed. Even so he managed to get his arms half up in a defensive block to try to stop her blow. Ordinarily she restrained her full strength when fighting humans as she was mindful of just how deadly her full force could be. But against this opponent? Well, she just didn’t give a damn if she hurt him. His arms were in the way of her blow but were nowhere near strong enough to stop or deflect it. As her right arm swung up in an arc, it hit both his fore arms, breaking the ulna bones and then both Radius bones as it brushed them aside and continued up to his jaw with the speed and impact of an express train, the back of her hand and her wrist catching him full force on the chin. She heard it break in two places and the crunch as his bottom jaw drove into his top one, knocking three teeth out as he was lifted off his feet and flung back twelve feet into the far wall. There was a satisfying crunch on impact as several more bones snapped, mostly ribs, before a final crack as the body fell to the floor and his left leg bent and broke beneath him. There was an indentation of cracked brick and broken plaster left on the wall where he had impacted. The body landed in an ungainly heap. She didn’t bother looking at the results of her handiwork.


There was silence in the room as she replaced her hand at her hip.


“I guess he didn’t believe the tales about the Angel.” The Reacher said, almost with amusement.


“I-I think he might be dead…” Jaeger said, horrified.


Her eyes narrowed as she turned to look at him, tilting her head “Oooooh, I hope so.” She said with relish through pursed lips to the telepath.


Jaeger went white. “Something is wrong…this is not in her nature…the media scans said nothing of this!” he said, panicked.


“Well then, I guess you shouldn’t believe everything you see on t.v.” Supergirl said, looking back once more at the All-Father.


One of the warriors stepped towards her as more rushed in from other parts of the building.


“Seriously? After that?” she gestured towards Bar Hau-Chai’s crumpled form. ”You still gonna try it on? You do know I can boil the fluid in your eyeballs if I want to, right?”


The young warrior froze, looking from Galen to the All-Father with a pained expression of terror on his face. The newly arrived warriors froze too. Jaeger flashed a quick message to them and the others in different parts of the mansion telepathically.
It was one word, a command : ‘ARM!’


The Reacher caught the message too, and exchanged a sad look at his younger rival. He didn’t say anything. He was fully aware of Jaeger’s contempt for him and always had been, as well as of the younger man’s ambition to supplant him. Once you were head of the Telepathic Order, you really did know that everyone was out to get you. He just locked his gaze to Jaeger and shook his head slightly, a wistful smile on his face. Jaeger frowned back at him. The Reacher’s smile broadened as he liked seeing the younger man unsettled by events. Normally Jaeger was so annoyingly self-assured.


Supergirl was aware that most of the future refugees had assembled around the doorways to the recreation wing and were looking in fearfully.


“I have no quarrel with most of you, directly. If you want to stay out of this, just go and wait in your rooms. If any of you truly view me as a Goddess , then obey my will over the All-Father. Those who side with him… will regret it.”


She let her words hang in the air and again nobody spoke for a long moment. She was aware of some of the people disappearing and others reappearing around her, but all the while her gaze never moved from the aged patriarch.


She was surprised slightly when the Reacher spoke, addressing the group. “Please, this is a matter for the Warriors and the Telepaths. Retire as she directs…”


Some female members of the Worker Caste, most of the Scientists and the remaining Breeders disappeared into the depths of the building. She was aware of some of the Warriors appearing behind her and to left and right. This time the shimmer suits were covered in reflective body armour, a tight fitting helmet with a visor was covering their faces and they carried a long metallic rifle-like weapon. She recognised them as ‘Charge Guns’ from the media orb, though she had seen no footage of them in action. It seemed to fire static electricity-charged bolts. She had just appraised the weapon when the first one opened fire. She inhaled and then blew in the micro-instant that she saw his finger twitch over what she took to be an arming switch and deflected the muzzle up toward the ceiling. Like all their technology it was thought operated but the arming pad needed to be covered to allow it to fire. She knew his shot would now miss her, but to her surprise the charge that it emitted arced crazily out towards her like the energy beams in ‘Ghostbusters’. She spun her shoulder back at the last minute and it barely missed her, crackling lightly across her chest.
But by that time two more of the weapons had fired, and the second caught her squarely in the centre of her back.


“UNNNNNNNNGGGGGGGGGHHHHHHUUUUUUHHHHHHHH” she cried as the energy surge hit her, her back arching as her hands were flung up, her fists clawing the air at shoulder height. The third hit her then, just above the right hip and she doubled up in pain as the electric shocks powered through her. Fortunately, unlike the weapons in Ghostbusters, these lightning bolts were of only limited duration.


“OHHHH –HUH!” She gasped as she recovered. She blinked back the tears and shock and as the pain subsided she didn’t linger, flashing around the room at speeds quicker than the human eye she effortlessly disarmed the three warriors leaving the shocked troopers clutching empty air before they could fire again. Some of the engineers had sword-like blades and a few had the futuristic equivalent of crow bars and wrenches, a bizarre multitude of tools on the same shaft that could be extended or shortened at will, or rather at thought. They froze, hesitantly eyeing up the speeding blue and red blur and not liking their chances. She cast a quick flash of her heat vision on the metallic barrels of the charge guns, welding them together, then she hurled them into the indoor swimming pool some thirty feet away from her.
The demonstration was enough to convince two of the Workers, who lowered their weapons looking afraid and embarrassed in equal measure. Another one however hefted the blade he carried and rushed forward screaming “FOR THE EMPIRE! FOR EARTH ! FOR THE ALL-FATHER!!!”


Supergirl had already scanned the weapon and was fully aware that it could not break her skin. She caught the blade lazily with her open palm, a move that would have resulted in a severed hand for a human.


“Give me that!” she frowned angrily at the engineer as she snatched it from him.


“FORGIVE ME GODDESS!” he cried and dropped to one knee, head bowed, slightly surprising her in that he could go from ‘gung-go’ to ‘give up’ in a fraction of a second.


“Just…just go, wait in your room.” she said, slightly disgusted by his weak will, that saw him quite happy to hack a young woman down when he thought he could one moment, but completely cowering when he thought he might be hurt in the next. Somehow that seemed to be indicative of the Terran Order as a whole. She was well aware though, even as she said those words to him, that she was sounding like his mother.


She was vaguely aware too, that at the periphery of her vision the All-Father had removed a small object from beneath his robe that overlay the shimmersuit, but she was in truth more concerned that the crowd of semi-combatants disperse.


There were now only some nine of them left, a mix of warriors, engineers and a few scientists. The Reacher, Jaeger, Tjulias, Galen and the All Father were also there.


“Where is the telepath Jianko?” the All-Father asked suddenly casting a gaze around the room.


“She made contact with the Hive Mind, Sire…she is now mad.” The Reacher said sadly. “She was not ready, yet she tried to find the Angel when she was aboard the Deracon ship….”


Kara felt a pang of guilt at those words, though she barely knew her, but she mustn’t forget that she was now out to stop these people. Jianko’s removal from the fight was a plus point for her as it was one less telepath to worry about. After this was over, she would try and do whatever she could for her. But for now,…now she needed to be hard. Harsh. Cruel. To fight fire , with fire. All things normally alien to her nature. But whenever there was the slightest hint of her wavering, she thought of the bodies she had seen via the orb. Thousands of them. Thousands, indicative of millions. Millions as there were no pictures of the billions.
Suddenly it wasn’t so hard to take on the aspect of the tiger.


“Stay still child”. The All-Father commanded her as he opened the tiny red-velvet lined lead box he held in his hand. “We don’t wish to hurt you…”


Supergirl had no intention of standing still, or for that matter doing anything else that this creep told her to do, but as he opened the box fully, she felt the sapping sting of Kryptonite. Yet that was all it was – a slight sting. The piece he held was the size of a 5 cent piece, and with him standing some 12 feet from her, its impact was…well, slightly annoying at the moment and nothing more. It was like a bee sting to her, a minor irritation. It could still kill her if it came nearer, and perhaps if she swallowed it, or with a piece that small if she were exposed to it for a very long period of time, but she had no intention of letting either happen.
If he came closer to her, she would move away. It was that simple.


She was cautious, and wary of him now, but not afraid.


“You know what this is, of course?” he asked rhetorically, as he held the tiny piece up in his hand, rolling it between his thumb and forefinger. “It is not merely Kryptonite. Or rather it is, but it is also so much more. This…this is our means of salvation. THIS WILL SAVE A SPECIES! MANKIND! Because with this…we can control you. One of our Warriors lost his life obtaining this from your Earth Sciences Facility. I have to confess, I thought it would have been a bigger sample.” To her surprise he popped it back in the box, closed the lid and threw it lazily to Galen, who disappeared from view with it. “But no matter. I have no intention of using that little piece of green poison against you. Because, we have THIS!” He held up a dull semi opaque colourless mineral, roughly the size of a baseball but more elongated in shape, that he picked up from a side table. It looked vaguely like a large lump of quartz, but was dull and greyer.
As far as she could tell from a quick scan it had no discerning properties that were harmful whatsoever. But it was like no conventional mineral she had ever encountered.


“OOOO” she said sarcastically, going wide –eyed and waggling her fingers either side of her head.
“NOT THAT!!!” She didn’t usually display such sarcastic frivolity but today she had done a lot of things she didn’t usually do. She just hated his theatrics. But more importantly, her talking was a means of buying time before he did anything, thereby allowing her time to scan the rock and decide what to do.


“Do you know what this is, child?” His benign grandfather persona was gone now and he was simply cold, compassionless. Clinical. She had scanned its mineral composition but it seemed to be a strange jumble of almost every element, even a speck of Kryptonite, but far too small to cause her any ill effects.


“THIS…” he paused dramatically “ is found ONLY on the Gendruz Moon of the Addison Haven colony.
It's known as ‘Chameleon Ore' as if you rub it, like so – “ he rubbed it several times against the metal handlebar of one of the exercise bikes “It becomes whatever it touches-“ she looked on in amazement as the dull crystalline stone suddenly became a lump of steel, mimicking the metal handlebar, even down to its chemical composition, as far as her sight could allow her to tell. “Well any non-living substance. Solids that is, metals we use it for mostly. It always works on all metals. It doesn’t last very long, a few days only and it cannot be worked in quite the same way as the normal material can. For example, if I were to break a piece off of this sample, the smaller piece would revert back to its normal state. It’s like it has a kind of memory for what it touches. Or rather rubs against, as one touch is not enough. Not quite everything but all metals, minerals and most polymers and ceramics. It is extremely useful. Especially now.”


Ok,’ she thought, ‘now this was much more serious.’ But still, as long as she kept the rock in his hand away from the tiny piece of Kryptonite that they had stolen, she could handle it. She stared at him impassively.


“You don’t seriously think I’m gonna let you put that Kryptonite anywhere near that rock you’re holding, do you?” she asked, folding her arms as she dipped her head indicatively and raised her eyebrows in a questioning glance.


“Oh, my dear child, YOU don’t seriously think that this is the only piece we have, or that we haven’t done that already?” he said with a slight smirk.


As his words sank in, Galen appeared in the doorway holding a large lump of the Chameleon Ore that now glowed green and was, to all intents and purposes, Kryptonite. She felt the sapping effect on her strength almost immediately and then a searing, burning sensation all down her right side as two more pieces of the ore appeared much closer to her. At every exit to the room a Warrior, Worker or Scientist now stood, each holding a piece of the ore that was now killing her. It was a strange sensation; it was like Kryptonite exposure, but yet different. The effects were undoubtedly harmful but were slightly less proportionate to the size of the rock than true Kryptonite would have been. If she had truly been surrounded by some six or seven large pieces of her home planet she would have probably blacked out. She was weakened and in terrible pain but still functioning. She tried to fly, to burst through the glass skylight in the ceiling, but instead she simply hopped into the air and landed, her flight powers clearly drained. She was genuinely afraid now as they encircled her, and someone appeared behind her, blocking the patio door exit, giving her no choice but to back away from them. Turning constantly, each step she took backward was matched by them taking one forward. There was only one direction she could go as she was surrounded on three sides and part of the fourth. She edged away, off to her left, fighting down the nausea and the pain that the rocks were instilling in her. She stepped, a painful footfall at a time, away from them, heading towards the open wall on the side of the room. Out of the gymnasium. And towards the indoor swimming pool.


“Things could have been so different , Angel.” The All-Father said sadly. “But now…now I think you’re beyond salvation…” his cold voice tailed off as he smiled cruelly. She felt her feet come down on the tiles at the poolside and glanced over her shoulder. She was some two feet from the edge of the water. The antique clock was ticking loudly, the sound echoing from the pool tiles and the surface of the water, like the clanging chimes of her doom. This whole saga had been about time and now, it was clearly running out for her. She cast her eye bitterly at the large thermometer alongside the clock. ‘It should be an hourglass’ she thought to herself. Except she didn’t have an hour. Her heels touched the pool side. Her body ached, wracked with pain. She could feel the waves of agony wash over her as the ore on all sides sapped her strength, seeming to rip her powers from every cell of her body. But worse, somehow, was the pain she felt inside, the pain of failure that gripped her heart and filled her with dread for the future.


The FUTURE. She smiled then, despite the pain, as she realised they couldn’t harm her. She was beyond their powers. If they did kill her, all well and good. For if they killed her now, this night, then she knew she had won. For who would save the First father if she were to die? And if they didn’t kill her this night…well, she was damned sure she was gonna kick their ass. Suddenly, this dire predicament became a win-win scenario for her, and though still in pain, she was no longer afraid.
She didn’t want to die, but now, armed with that realisation, she was not afraid to.


In spite of her agony, she smiled, locking a steady gaze at the grinning All-Father. He smiled back for a moment, but then his face changed as he looked into her clear blue eyes. He didn’t need to be telepathic to detect the change in her. He was the head of a dynasty that fed on fear, that relished cruelty, that enjoyed destruction, but he realised as he looked into her ice cold eyes that for all his powers of office, for all the aces he held in his hand over her, she would not break, she would not be beaten. She could never be beaten. His mouth went dry and his smile wavered on his lips. He licked them nervously. To people who thrive on fear, being confronted by the fearless, by those that you knew would never bow down to you, undermined your entire philosophy of existence.


The Reacher watched his reactions with something approaching amusement. He flicked his gaze between Kara and the All-Father, and his mind followed suit. He realised she had made the connection, something Galen, Tjulias and the All-Father were still nowhere near making, between these events tonight and the need for her to save the First Father in just a few weeks. Oh, they knew that it would be better for her to live, not least because killing her would be a long and difficult process, but also with her alive they had an endless supply of her genetic material, be it blood or skin cells or DNA strands, so they wanted her alive. But they had not remembered the real need for her to live, to save the First Father. And with what they were doing to her now, it made that much less likely. The scientists had just been carried away in the moment. The warriors were known for their brawn not their brains. But Jaeger and the All-Father? They should have known better. Though it was forbidden to do so, The Reacher had read the All-Father for years. The Reacher could sense the fear and confusion building in the All-Father. It was in direct contrast to the confidence rising in Kara. She was suffering, that was clear, but she seemed to have made her mind up, that whatever happened to her now, no longer mattered. She was, he admitted to himself, truly brave, something that he was not completely convinced of before this moment. If you are virtually indestructible then it’s nothing to look down the barrel of a shotgun or take on armed thugs who have no means of hurting you. So, for all Kara’s exploits that the media scans had revealed, was she genuinely brave to do such things? No. Dedicated to helping her fellow man, yes. But brave…? Not really. But now, faced with almost unbearable pain and the very real prospect of a terrible end for her, to realise that you will survive but that such torment may go on indefinitely and to still seek out that outcome or else death, for the fate of mankind…that was truly courageous. The Reacher’s respect for her grew.


Even though she was in terrible pain, as she stood teetering on the edge of the pool she knew that even in death she could win. And so what was there to fear? She had been afraid of failure, not of pain. If her young life ended tonight, then so be it. The future would change, the First Father would perish, the Second Father would never be born and the Order would never rise to power.


She remembered a true story Rob had told her, about Bertha Fraser, a female French Resistance member who had been captured and tortured by the Gestapo to learn the names of her resistance group. Brutally tortured. For 28 weeks. They beat her and publicly flogged her and systematically broke her arms and broke her ribs and pulled out all of her toe nails and finally removed all of her fingernails. But she never talked. And when the last fingernail was plucked and they had no more horrors to inflict upon her… the young Gestapo officer who conducted the torture broke down and cried. She had never understood that story fully until now. But now…now it made sense. When the last fingernail was taken everything that her tormentors had been taught to believe was proved to be false. That might was always right. That the weak always broke. That force and cruelty could solve anything. That fascism would always triumph. And ironically that same morning, after the last nail was pulled, the cry had gone up outside the walls of her prison at Loos- ‘La Liberation est ici!’ as the Allies had landed in Normandy. Both occupants of the condemned cell had heard it, and both knew what it meant for the other. And when that young Nazi officer looked at his supposed victim, he had nothing else left to offer, having literally used every trick in the book, every method of torture that he had been taught. And then it didn’t even matter anyway, to his side at least. She had broken him. He had the might of a state that had dominated and enslaved Europe behind him and yet it was not enough against the incredible bravery of one woman, armed only with the power of her convictions and the certain knowledge that a belief in freedom was far stronger than any belief in tyranny. And that was just one ordinary human being. One ordinary, extraordinary human being, with limitless courage. For all human beings are extraordinary in different ways. And that was what Kara was fighting for now. Billions of lives, yes. But billions of individuals. Not the human race – but each and every single human that made it up, a small but important distinction. That was what she was trying to save. Was what she would save. They were with her now in spirit; she could almost feel them, each and every one of them, billions of them. And that was why these people and their kind would always ultimately fail. She had them hopelessly outnumbered.

She forced a wide grin, though the pain caused tears to prick at the corners of her eyes. Pain she could endure. Failure she could not. They couldn’t kill her, they needed her more than just for her DNA. They still needed her to save the First Father. Armed with that knowledge, she knew that all they could do to coerce her was to hurt her. To inflict pain; to push her to the limits of endurance; to take her to the very edge of death. Yet if they went too far they could kill her, accidentally. But even if she did die, she would break the cycle and deny the existence of this entire future society. She’d be happy with that as a minimum outcome. But knowing they had to keep her alive, gave her power.


The Reacher watched her impassively, but inwardly he was delighted. Just a few days ago he had not even believed that she had ever existed, that she was probably the figment of a child’s imagination. Yet now, now he would actually get to see her in action, in all her glory. He was quite excited.


She cast a quick glance around at the others. “Bring it on, guys.” she smiled through her tears.
“Bring.
It.
On.”
How strange are the ways of the gods ...........and how cruel.

I am here to help one and all enjoy this site, so if you have any questions or feel you are being trolled please contact me (Hit the 'CONTACT' little speech bubble below my Avatar).
User avatar
valugi
Staff Sargeant
Staff Sargeant
Posts: 160
Joined: 14 years ago

Re: Supergirl and the Last Human

chapter was very good, the interesting point that came supergirl in this story
User avatar
SGWriter
Story General
Story General
Posts: 1112
Joined: 22 years ago

Re: Supergirl and the Last Human

Tallyho, you just did something in this story I've always wanted to see. Supergirl surrounded by baddies each holding kryptonite closing in on all sides. It was a sweet reveal and like how Kara is weakened but she is still defiant at the end. Another good cliffhanger dude!
Yes Supergirl, that's right its a necklace for you....What's the matter you don't like Kryptonite?
Post Reply